\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0522551271:

Variant ID: vg0522551271 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 22551271
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, T: 0.16, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:


ACAAATTTCTATGATTCAACAATATACTCTATTAATTTATATGCTTCTTTATACCAAAGGGCAAACTGGACTTTTTTATAAGAATTTAACGGTCAACTAA[C/T]
GGTCAACTAATGGTCAACTAGCGGAAAGGGCATGGAAGGGATCCAAACTAAAATTCAGGGATATGTAAGGGATTGAGCAAAATTCAGAGGTACAGAAGGG

Reverse complement sequence

CCCTTCTGTACCTCTGAATTTTGCTCAATCCCTTACATATCCCTGAATTTTAGTTTGGATCCCTTCCATGCCCTTTCCGCTAGTTGACCATTAGTTGACC[G/A]
TTAGTTGACCGTTAAATTCTTATAAAAAAGTCCAGTTTGCCCTTTGGTATAAAGAAGCATATAAATTAATAGAGTATATTGTTGAATCATAGAAATTTGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.50% 37.70% 5.14% 6.71% NA
All Indica  2759 82.50% 2.10% 4.71% 10.76% NA
All Japonica  1512 0.70% 98.90% 0.13% 0.20% NA
Aus  269 24.20% 34.60% 37.92% 3.35% NA
Indica I  595 79.20% 0.80% 8.24% 11.76% NA
Indica II  465 74.40% 2.20% 2.80% 20.65% NA
Indica III  913 90.80% 1.30% 2.96% 4.93% NA
Indica Intermediate  786 80.00% 3.80% 5.22% 10.94% NA
Temperate Japonica  767 0.50% 99.30% 0.00% 0.13% NA
Tropical Japonica  504 0.60% 99.00% 0.00% 0.40% NA
Japonica Intermediate  241 1.70% 97.50% 0.83% 0.00% NA
VI/Aromatic  96 1.00% 96.90% 1.04% 1.04% NA
Intermediate  90 37.80% 45.60% 8.89% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0522551271 C -> T LOC_Os05g38450.1 downstream_gene_variant ; 4228.0bp to feature; MODIFIER silent_mutation Average:73.217; most accessible tissue: Zhenshan97 root, score: 93.819 N N N N
vg0522551271 C -> T LOC_Os05g38460.1 downstream_gene_variant ; 2032.0bp to feature; MODIFIER silent_mutation Average:73.217; most accessible tissue: Zhenshan97 root, score: 93.819 N N N N
vg0522551271 C -> T LOC_Os05g38450-LOC_Os05g38460 intergenic_region ; MODIFIER silent_mutation Average:73.217; most accessible tissue: Zhenshan97 root, score: 93.819 N N N N
vg0522551271 C -> DEL N N silent_mutation Average:73.217; most accessible tissue: Zhenshan97 root, score: 93.819 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0522551271 NA 2.76E-66 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522551271 9.36E-06 NA mr1080 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522551271 NA 6.72E-80 mr1100 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522551271 NA 3.06E-40 mr1124 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522551271 NA 1.18E-10 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522551271 NA 4.34E-31 mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522551271 NA 1.60E-16 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522551271 NA 1.24E-88 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522551271 NA 7.18E-67 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522551271 NA 2.88E-20 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522551271 NA 1.29E-43 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522551271 NA 4.49E-57 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522551271 NA 3.20E-68 mr1619 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522551271 NA 5.38E-22 mr1689 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522551271 NA 3.28E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522551271 NA 1.91E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522551271 NA 6.56E-89 mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522551271 NA 2.87E-34 mr1733 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522551271 NA 3.39E-30 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522551271 2.35E-06 3.92E-114 mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522551271 NA 3.94E-90 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522551271 NA 5.38E-59 mr1795 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522551271 NA 6.06E-39 mr1828 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522551271 NA 4.81E-55 mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522551271 NA 2.49E-40 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522551271 NA 5.82E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522551271 NA 4.29E-15 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522551271 NA 3.75E-62 mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522551271 NA 8.91E-24 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522551271 NA 2.43E-65 mr1828_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251