\
| Variant ID: vg0522542822 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 22542822 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 195. )
ATTAATCTCTATCGGGCTTTAACTAAGGCCCGTCACCGATGACTATTTTTCCATTTTTCCAAACAAGTCTTTATATTTGTGCGTACAAAATATATAGTTG[T/C]
TGTATAATAATTCATTTTATTAGGCATAATACATTTTCGGGTACTAAACAGCATTTGTAAATACTAAATGATTTCAAATGGAAATATGGTCAAAAACAAA
TTTGTTTTTGACCATATTTCCATTTGAAATCATTTAGTATTTACAAATGCTGTTTAGTACCCGAAAATGTATTATGCCTAATAAAATGAATTATTATACA[A/G]
CAACTATATATTTTGTACGCACAAATATAAAGACTTGTTTGGAAAAATGGAAAAATAGTCATCGGTGACGGGCCTTAGTTAAAGCCCGATAGAGATTAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.00% | 40.90% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 89.10% | 10.80% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 65.70% | 34.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.60% | 8.10% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 47.80% | 51.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0522542822 | T -> C | LOC_Os05g38450.1 | upstream_gene_variant ; 2012.0bp to feature; MODIFIER | silent_mutation | Average:27.691; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0522542822 | T -> C | LOC_Os05g38430.1 | downstream_gene_variant ; 583.0bp to feature; MODIFIER | silent_mutation | Average:27.691; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0522542822 | T -> C | LOC_Os05g38440.1 | downstream_gene_variant ; 1137.0bp to feature; MODIFIER | silent_mutation | Average:27.691; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0522542822 | T -> C | LOC_Os05g38430-LOC_Os05g38440 | intergenic_region ; MODIFIER | silent_mutation | Average:27.691; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0522542822 | NA | 8.30E-17 | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522542822 | NA | 9.90E-06 | mr1229 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522542822 | NA | 1.98E-10 | mr1332 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522542822 | NA | 3.73E-12 | mr1386 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522542822 | NA | 3.60E-06 | mr1403 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522542822 | NA | 3.25E-13 | mr1641 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522542822 | NA | 2.86E-07 | mr1659 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522542822 | NA | 3.80E-21 | mr1754 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522542822 | NA | 1.67E-06 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522542822 | NA | 4.88E-21 | mr1838 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522542822 | NA | 9.63E-12 | mr1846 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522542822 | NA | 8.21E-15 | mr1909 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522542822 | NA | 1.74E-11 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522542822 | NA | 1.18E-13 | mr1838_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522542822 | NA | 3.57E-14 | mr1846_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |