\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0522542822:

Variant ID: vg0522542822 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 22542822
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


ATTAATCTCTATCGGGCTTTAACTAAGGCCCGTCACCGATGACTATTTTTCCATTTTTCCAAACAAGTCTTTATATTTGTGCGTACAAAATATATAGTTG[T/C]
TGTATAATAATTCATTTTATTAGGCATAATACATTTTCGGGTACTAAACAGCATTTGTAAATACTAAATGATTTCAAATGGAAATATGGTCAAAAACAAA

Reverse complement sequence

TTTGTTTTTGACCATATTTCCATTTGAAATCATTTAGTATTTACAAATGCTGTTTAGTACCCGAAAATGTATTATGCCTAATAAAATGAATTATTATACA[A/G]
CAACTATATATTTTGTACGCACAAATATAAAGACTTGTTTGGAAAAATGGAAAAATAGTCATCGGTGACGGGCCTTAGTTAAAGCCCGATAGAGATTAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.00% 40.90% 0.06% 0.00% NA
All Indica  2759 89.10% 10.80% 0.07% 0.00% NA
All Japonica  1512 0.80% 99.20% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 65.70% 34.30% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 98.00% 2.00% 0.00% 0.00% NA
Indica Intermediate  786 91.60% 8.10% 0.25% 0.00% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 47.80% 51.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0522542822 T -> C LOC_Os05g38450.1 upstream_gene_variant ; 2012.0bp to feature; MODIFIER silent_mutation Average:27.691; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0522542822 T -> C LOC_Os05g38430.1 downstream_gene_variant ; 583.0bp to feature; MODIFIER silent_mutation Average:27.691; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0522542822 T -> C LOC_Os05g38440.1 downstream_gene_variant ; 1137.0bp to feature; MODIFIER silent_mutation Average:27.691; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0522542822 T -> C LOC_Os05g38430-LOC_Os05g38440 intergenic_region ; MODIFIER silent_mutation Average:27.691; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0522542822 NA 8.30E-17 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522542822 NA 9.90E-06 mr1229 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522542822 NA 1.98E-10 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522542822 NA 3.73E-12 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522542822 NA 3.60E-06 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522542822 NA 3.25E-13 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522542822 NA 2.86E-07 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522542822 NA 3.80E-21 mr1754 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522542822 NA 1.67E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522542822 NA 4.88E-21 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522542822 NA 9.63E-12 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522542822 NA 8.21E-15 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522542822 NA 1.74E-11 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522542822 NA 1.18E-13 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522542822 NA 3.57E-14 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251