Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0522383666:

Variant ID: vg0522383666 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 22383666
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


GCAACCTTCCTCGTGCCGCCCATTGCGTGGTCACCACCCTTGCCAACTCCGCCCGTTGGGGGGCCATCCTTCGGCCTCTGCTCTAGACCGCTACCGTTGT[C/T]
GGGTCTTATCCATAACAGTATAGTGGGGTGGCTTTGTCTGACATGGCAATTTGACCCAAGTCAACAACGCTGAGTCATTGTGGACAACATATGTCACAAC

Reverse complement sequence

GTTGTGACATATGTTGTCCACAATGACTCAGCGTTGTTGACTTGGGTCAAATTGCCATGTCAGACAAAGCCACCCCACTATACTGTTATGGATAAGACCC[G/A]
ACAACGGTAGCGGTCTAGAGCAGAGGCCGAAGGATGGCCCCCCAACGGGCGGAGTTGGCAAGGGTGGTGACCACGCAATGGGCGGCACGAGGAAGGTTGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.60% 49.40% 0.04% 0.00% NA
All Indica  2759 82.70% 17.20% 0.07% 0.00% NA
All Japonica  1512 1.00% 99.00% 0.00% 0.00% NA
Aus  269 20.10% 79.90% 0.00% 0.00% NA
Indica I  595 97.10% 2.90% 0.00% 0.00% NA
Indica II  465 89.50% 10.30% 0.22% 0.00% NA
Indica III  913 70.40% 29.50% 0.11% 0.00% NA
Indica Intermediate  786 82.10% 17.90% 0.00% 0.00% NA
Temperate Japonica  767 0.80% 99.20% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 40.00% 60.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0522383666 C -> T LOC_Os05g38150.1 upstream_gene_variant ; 2627.0bp to feature; MODIFIER silent_mutation Average:93.177; most accessible tissue: Zhenshan97 panicle, score: 96.214 N N N N
vg0522383666 C -> T LOC_Os05g38160.1 upstream_gene_variant ; 472.0bp to feature; MODIFIER silent_mutation Average:93.177; most accessible tissue: Zhenshan97 panicle, score: 96.214 N N N N
vg0522383666 C -> T LOC_Os05g38150.2 upstream_gene_variant ; 2627.0bp to feature; MODIFIER silent_mutation Average:93.177; most accessible tissue: Zhenshan97 panicle, score: 96.214 N N N N
vg0522383666 C -> T LOC_Os05g38170.1 downstream_gene_variant ; 4282.0bp to feature; MODIFIER silent_mutation Average:93.177; most accessible tissue: Zhenshan97 panicle, score: 96.214 N N N N
vg0522383666 C -> T LOC_Os05g38150-LOC_Os05g38160 intergenic_region ; MODIFIER silent_mutation Average:93.177; most accessible tissue: Zhenshan97 panicle, score: 96.214 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0522383666 C T 0.0 0.0 0.0 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0522383666 NA 5.12E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522383666 NA 2.80E-16 mr1147 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522383666 NA 2.29E-06 mr1187 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522383666 NA 7.94E-15 mr1199 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522383666 NA 5.75E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522383666 NA 2.15E-09 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522383666 NA 5.12E-16 mr1329 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522383666 NA 2.22E-13 mr1524 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522383666 NA 7.18E-26 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522383666 NA 1.29E-19 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522383666 NA 3.35E-12 mr1581 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522383666 NA 4.20E-12 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522383666 NA 2.36E-08 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522383666 NA 7.09E-16 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522383666 NA 1.32E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522383666 NA 6.35E-06 mr1749 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522383666 NA 2.38E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522383666 NA 3.57E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522383666 NA 3.01E-10 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522383666 NA 5.66E-10 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522383666 NA 2.57E-11 mr1883 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522383666 NA 1.65E-08 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522383666 NA 4.36E-11 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251