\
| Variant ID: vg0522357374 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr05 | Position: 22357374 |
| Reference Allele: TGG | Alternative Allele: T,CGG |
| Primary Allele: T | Secondary Allele: TGG |
Inferred Ancestral Allele: Not determined.
TTTAATCTAGAATTCTTTCCTATCCTACTACACGTAATGTGCAATGAGGGTTGGCTTGTTGTTTATGTTTAGTTTCATTTGTTCTTCCATATTTTGTATG[TGG/T,CGG]
TGCTTCATCCTTGTGCAATTGTGTATGTACCGGCATTCTAATGTTGGTGCTTGATTTCAGGTATCCAACTGACAGCGATAAGCAGATGCTTGCTAAACAG
CTGTTTAGCAAGCATCTGCTTATCGCTGTCAGTTGGATACCTGAAATCAAGCACCAACATTAGAATGCCGGTACATACACAATTGCACAAGGATGAAGCA[CCA/A,CCG]
CATACAAAATATGGAAGAACAAATGAAACTAAACATAAACAACAAGCCAACCCTCATTGCACATTACGTGTAGTAGGATAGGAAAGAATTCTAGATTAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of TGG(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.60% | 34.10% | 0.36% | 0.30% | CGG: 0.68% |
| All Indica | 2759 | 98.30% | 0.90% | 0.11% | 0.36% | CGG: 0.33% |
| All Japonica | 1512 | 1.20% | 96.50% | 0.79% | 0.07% | CGG: 1.46% |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.30% | 0.00% | 0.50% | NA |
| Indica II | 465 | 98.30% | 1.30% | 0.00% | 0.22% | CGG: 0.22% |
| Indica III | 913 | 99.30% | 0.40% | 0.00% | 0.11% | CGG: 0.11% |
| Indica Intermediate | 786 | 96.40% | 1.70% | 0.38% | 0.64% | CGG: 0.89% |
| Temperate Japonica | 767 | 0.80% | 94.90% | 1.43% | 0.00% | CGG: 2.87% |
| Tropical Japonica | 504 | 1.20% | 98.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.10% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 41.10% | 2.22% | 3.33% | CGG: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0522357374 | TGG -> T | LOC_Os05g38120.1 | intron_variant ; MODIFIER | silent_mutation | Average:59.667; most accessible tissue: Zhenshan97 panicle, score: 76.605 | N | N | N | N |
| vg0522357374 | TGG -> DEL | N | N | silent_mutation | Average:59.667; most accessible tissue: Zhenshan97 panicle, score: 76.605 | N | N | N | N |
| vg0522357374 | TGG -> CGG | LOC_Os05g38120.1 | intron_variant ; MODIFIER | silent_mutation | Average:59.667; most accessible tissue: Zhenshan97 panicle, score: 76.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0522357374 | NA | 1.10E-07 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0522357374 | 7.39E-07 | 7.39E-07 | mr1008 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | 4.03E-06 | 4.03E-06 | mr1009 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | NA | 4.39E-13 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | NA | 2.62E-26 | mr1072 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | NA | 3.60E-29 | mr1075 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | 9.10E-06 | NA | mr1124 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | NA | 7.17E-06 | mr1140 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | NA | 2.76E-13 | mr1149 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | NA | 9.33E-08 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | 5.88E-06 | 1.79E-30 | mr1202 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | NA | 1.98E-27 | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | 6.46E-06 | 3.42E-31 | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | NA | 2.59E-17 | mr1484 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | NA | 1.25E-19 | mr1541 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | NA | 2.41E-19 | mr1566 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | NA | 1.15E-43 | mr1591 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | NA | 1.41E-13 | mr1592 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | NA | 6.55E-59 | mr1594 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | NA | 8.36E-08 | mr1613 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | NA | 4.48E-12 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | NA | 3.66E-39 | mr1645 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | NA | 2.54E-32 | mr1647 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | NA | 4.05E-09 | mr1663 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | NA | 1.11E-37 | mr1719 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | NA | 1.56E-29 | mr1737 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | NA | 4.50E-113 | mr1750 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | NA | 1.98E-51 | mr1795 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | 3.24E-07 | 4.38E-54 | mr1861 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | NA | 3.13E-13 | mr1874 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | NA | 1.39E-39 | mr1890 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | NA | 1.51E-39 | mr1891 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | NA | 5.48E-15 | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | NA | 8.95E-07 | mr1962 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | NA | 3.01E-16 | mr1416_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | NA | 2.82E-29 | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | NA | 2.34E-19 | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522357374 | NA | 1.18E-18 | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |