Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0522272712:

Variant ID: vg0522272712 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 22272712
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCGGGCCAAAATATCGTGCCATGGTCCGGACCGTCGGGCCTTGGGCCTTTTGGCCATCTATACGGGAGAGGAGCGATCGACGCGTTCTTCTCTCTCTCC[C/T]
TCCCGGCGATCCTTCCTCGCCGGCGAGCGCACACGGAGAGAGAAAAAGGTTGCGGCCGGCGAGGAGGGCAGAGACGGTCGCTGTCCACCGCCCGCTGCGC

Reverse complement sequence

GCGCAGCGGGCGGTGGACAGCGACCGTCTCTGCCCTCCTCGCCGGCCGCAACCTTTTTCTCTCTCCGTGTGCGCTCGCCGGCGAGGAAGGATCGCCGGGA[G/A]
GGAGAGAGAGAAGAACGCGTCGATCGCTCCTCTCCCGTATAGATGGCCAAAAGGCCCAAGGCCCGACGGTCCGGACCATGGCACGATATTTTGGCCCGGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.50% 36.30% 0.21% 0.00% NA
All Indica  2759 98.40% 1.40% 0.25% 0.00% NA
All Japonica  1512 1.10% 98.80% 0.07% 0.00% NA
Aus  269 81.80% 18.20% 0.00% 0.00% NA
Indica I  595 99.20% 0.50% 0.34% 0.00% NA
Indica II  465 98.30% 1.50% 0.22% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 96.60% 2.90% 0.51% 0.00% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.50% 0.41% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 48.90% 48.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0522272712 C -> T LOC_Os05g37970.1 upstream_gene_variant ; 3570.0bp to feature; MODIFIER silent_mutation Average:87.006; most accessible tissue: Minghui63 panicle, score: 95.014 N N N N
vg0522272712 C -> T LOC_Os05g37970.3 upstream_gene_variant ; 3334.0bp to feature; MODIFIER silent_mutation Average:87.006; most accessible tissue: Minghui63 panicle, score: 95.014 N N N N
vg0522272712 C -> T LOC_Os05g37970.2 upstream_gene_variant ; 3570.0bp to feature; MODIFIER silent_mutation Average:87.006; most accessible tissue: Minghui63 panicle, score: 95.014 N N N N
vg0522272712 C -> T LOC_Os05g37970.4 upstream_gene_variant ; 3570.0bp to feature; MODIFIER silent_mutation Average:87.006; most accessible tissue: Minghui63 panicle, score: 95.014 N N N N
vg0522272712 C -> T LOC_Os05g37950-LOC_Os05g37970 intergenic_region ; MODIFIER silent_mutation Average:87.006; most accessible tissue: Minghui63 panicle, score: 95.014 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0522272712 C T 0.09 0.08 0.08 0.06 0.07 0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0522272712 NA 3.30E-29 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522272712 NA 8.10E-78 mr1100 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522272712 NA 2.97E-40 mr1124 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522272712 NA 2.33E-42 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522272712 NA 2.06E-27 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522272712 NA 1.73E-32 mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522272712 NA 1.10E-24 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522272712 NA 1.49E-19 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522272712 NA 2.43E-44 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522272712 NA 2.71E-14 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522272712 NA 2.70E-59 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522272712 NA 1.15E-67 mr1619 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522272712 NA 5.25E-74 mr1629 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522272712 NA 3.76E-57 mr1671 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522272712 2.38E-08 2.17E-92 mr1718 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522272712 NA 6.92E-34 mr1733 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522272712 NA 3.91E-31 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522272712 NA 1.60E-86 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522272712 NA 1.11E-55 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522272712 NA 4.52E-35 mr1828 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522272712 NA 5.82E-23 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522272712 NA 2.18E-44 mr1890 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522272712 NA 1.07E-41 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522272712 NA 9.79E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522272712 NA 2.65E-25 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522272712 NA 8.16E-23 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522272712 NA 2.11E-81 mr1671_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522272712 NA 1.61E-38 mr1689_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522272712 NA 4.51E-115 mr1718_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522272712 NA 1.07E-34 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522272712 NA 1.62E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251