\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0522270472:

Variant ID: vg0522270472 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 22270472
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


TATGATGCATCGATGGACCATCTTATATATATAAATACCACAACGCGACCTTGCTCTTCTATGTGTATCCCACTTCACTGCTACGTTACATATAGTTTCT[A/G]
ATAATAGAATCACATAAGAGCGTGTATGATAAGGTGATATAAATGGGTTATAATGGTTGCCACCTTAAGTGTTGAGTTAGAGGAGAGAGGGGACGAGCGA

Reverse complement sequence

TCGCTCGTCCCCTCTCTCCTCTAACTCAACACTTAAGGTGGCAACCATTATAACCCATTTATATCACCTTATCATACACGCTCTTATGTGATTCTATTAT[T/C]
AGAAACTATATGTAACGTAGCAGTGAAGTGGGATACACATAGAAGAGCAAGGTCGCGTTGTGGTATTTATATATATAAGATGGTCCATCGATGCATCATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.90% 36.70% 0.08% 0.30% NA
All Indica  2759 98.10% 1.40% 0.04% 0.40% NA
All Japonica  1512 1.20% 98.60% 0.07% 0.13% NA
Aus  269 74.00% 26.00% 0.00% 0.00% NA
Indica I  595 99.20% 0.30% 0.00% 0.50% NA
Indica II  465 98.10% 1.70% 0.00% 0.22% NA
Indica III  913 99.30% 0.50% 0.00% 0.11% NA
Indica Intermediate  786 95.90% 3.20% 0.13% 0.76% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 98.60% 0.20% 0.20% NA
Japonica Intermediate  241 2.50% 97.10% 0.00% 0.41% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 52.20% 44.40% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0522270472 A -> DEL N N silent_mutation Average:70.571; most accessible tissue: Callus, score: 92.033 N N N N
vg0522270472 A -> G LOC_Os05g37950.1 upstream_gene_variant ; 3465.0bp to feature; MODIFIER silent_mutation Average:70.571; most accessible tissue: Callus, score: 92.033 N N N N
vg0522270472 A -> G LOC_Os05g37950-LOC_Os05g37970 intergenic_region ; MODIFIER silent_mutation Average:70.571; most accessible tissue: Callus, score: 92.033 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0522270472 NA 1.05E-67 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522270472 NA 9.97E-14 mr1218 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522270472 NA 3.00E-16 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522270472 NA 1.08E-38 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522270472 1.15E-07 NA mr1550 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522270472 NA 1.56E-44 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522270472 NA 1.17E-61 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522270472 NA 2.15E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522270472 NA 2.17E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522270472 NA 1.98E-80 mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522270472 NA 1.16E-117 mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522270472 NA 1.02E-34 mr1828 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522270472 NA 3.11E-22 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522270472 NA 7.14E-53 mr1889 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522270472 NA 4.72E-40 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522270472 NA 3.27E-41 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522270472 NA 4.15E-33 mr1256_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522270472 NA 3.01E-43 mr1542_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522270472 8.19E-08 NA mr1550_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522270472 NA 1.38E-16 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522270472 NA 1.07E-106 mr1718_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522270472 NA 2.50E-151 mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522270472 NA 5.47E-66 mr1889_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522270472 NA 6.69E-41 mr1944_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251