Variant ID: vg0522137809 (JBrowse) | Variation Type: SNP |
Chromosome: chr05 | Position: 22137809 |
Reference Allele: G | Alternative Allele: A,T |
Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTCCTCTACAGCTCGCCCGCTGCCGCCGTTCTTTATTATCATTGAGATTTTAAAATAAAAAATGATTATCATTGGGGTTTTTTTTTTTTACTTTTTAGAA[G/A,T]
CCCGAACCTTTAAAAAGTGAAACTTCTTATAGTTTTTAGAGTTTTATTGTCTCGATGGATTTCATGTTTTTTATAATTTTTAGAAATCCCGTCAAACACT
AGTGTTTGACGGGATTTCTAAAAATTATAAAAAACATGAAATCCATCGAGACAATAAAACTCTAAAAACTATAAGAAGTTTCACTTTTTAAAGGTTCGGG[C/T,A]
TTCTAAAAAGTAAAAAAAAAAAACCCCAATGATAATCATTTTTTATTTTAAAATCTCAATGATAATAAAGAACGGCGGCAGCGGGCGAGCTGTAGAGGAG
Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 98.90% | 0.40% | 0.25% | 0.00% | A: 0.36% |
All Indica | 2759 | 100.00% | 0.00% | 0.04% | 0.00% | NA |
All Japonica | 1512 | 97.80% | 1.40% | 0.73% | 0.00% | A: 0.13% |
Aus | 269 | 94.80% | 0.00% | 0.00% | 0.00% | A: 5.20% |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
Temperate Japonica | 767 | 96.70% | 2.00% | 1.30% | 0.00% | NA |
Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
Japonica Intermediate | 241 | 96.70% | 2.50% | 0.00% | 0.00% | A: 0.83% |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 98.90% | 0.00% | 0.00% | 0.00% | A: 1.11% |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0522137809 | G -> T | LOC_Os05g37800.1 | upstream_gene_variant ; 2237.0bp to feature; MODIFIER | silent_mutation | Average:31.614; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
vg0522137809 | G -> T | LOC_Os05g37790-LOC_Os05g37800 | intergenic_region ; MODIFIER | silent_mutation | Average:31.614; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
vg0522137809 | G -> A | LOC_Os05g37800.1 | upstream_gene_variant ; 2237.0bp to feature; MODIFIER | silent_mutation | Average:31.614; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
vg0522137809 | G -> A | LOC_Os05g37790-LOC_Os05g37800 | intergenic_region ; MODIFIER | silent_mutation | Average:31.614; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0522137809 | NA | 2.37E-08 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg0522137809 | 4.16E-07 | 6.04E-07 | mr1274 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0522137809 | NA | 1.81E-06 | mr1274_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0522137809 | NA | 2.15E-06 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0522137809 | NA | 7.93E-07 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |