| Variant ID: vg0522118727 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr05 | Position: 22118727 |
| Reference Allele: TA | Alternative Allele: AA,TAAA,TAA,T |
| Primary Allele: AA | Secondary Allele: TA |
Inferred Ancestral Allele: Not determined.
AGATGAAAAGGAGTATCTAATTTGTAGGAAATTGCCTCTTTGTAATTTTAAATATTACTTTTACTTAAAATTTGCTGGATAAAAGAACATAAGTTTTTTT[TA/AA,TAAA,TAA,T]
AAAAAAAATCGGCCAACGAGTTTGTGTGAAACCTAAGTACAAGCCCGAGTAGGTCGCCCACAACTGGGGACTTTACCAGTGCGCTAAAATTTTCAGTTTG
CAAACTGAAAATTTTAGCGCACTGGTAAAGTCCCCAGTTGTGGGCGACCTACTCGGGCTTGTACTTAGGTTTCACACAAACTCGTTGGCCGATTTTTTTT[TA/TT,TTTA,TTA,A]
AAAAAAACTTATGTTCTTTTATCCAGCAAATTTTAAGTAAAAGTAATATTTAAAATTACAAAGAGGCAATTTCCTACAAATTAGATACTCCTTTTCATCT
| Populations | Population Size | Frequency of AA(primary allele) | Frequency of TA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.40% | 34.40% | 2.24% | 0.57% | TAA: 0.23%; TAAA: 0.13%; T: 0.02% |
| All Indica | 2759 | 94.90% | 2.30% | 1.23% | 0.98% | TAA: 0.33%; TAAA: 0.22% |
| All Japonica | 1512 | 9.50% | 85.90% | 4.50% | 0.00% | TAA: 0.13% |
| Aus | 269 | 50.90% | 48.70% | 0.00% | 0.00% | T: 0.37% |
| Indica I | 595 | 92.60% | 1.70% | 3.19% | 1.18% | TAA: 0.84%; TAAA: 0.50% |
| Indica II | 465 | 97.00% | 1.70% | 0.65% | 0.43% | TAA: 0.22% |
| Indica III | 913 | 97.20% | 0.90% | 0.22% | 1.53% | TAAA: 0.22% |
| Indica Intermediate | 786 | 92.90% | 4.80% | 1.27% | 0.51% | TAA: 0.38%; TAAA: 0.13% |
| Temperate Japonica | 767 | 12.40% | 80.40% | 7.04% | 0.00% | TAA: 0.13% |
| Tropical Japonica | 504 | 5.40% | 93.10% | 1.39% | 0.00% | TAA: 0.20% |
| Japonica Intermediate | 241 | 8.70% | 88.40% | 2.90% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 43.30% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0522118727 | TA -> DEL | N | N | silent_mutation | Average:62.589; most accessible tissue: Callus, score: 92.093 | N | N | N | N |
| vg0522118727 | TA -> TAAA | LOC_Os05g37780.1 | upstream_gene_variant ; 4113.0bp to feature; MODIFIER | silent_mutation | Average:62.589; most accessible tissue: Callus, score: 92.093 | N | N | N | N |
| vg0522118727 | TA -> TAAA | LOC_Os05g37770-LOC_Os05g37780 | intergenic_region ; MODIFIER | silent_mutation | Average:62.589; most accessible tissue: Callus, score: 92.093 | N | N | N | N |
| vg0522118727 | TA -> T | LOC_Os05g37780.1 | upstream_gene_variant ; 4114.0bp to feature; MODIFIER | silent_mutation | Average:62.589; most accessible tissue: Callus, score: 92.093 | N | N | N | N |
| vg0522118727 | TA -> T | LOC_Os05g37770-LOC_Os05g37780 | intergenic_region ; MODIFIER | silent_mutation | Average:62.589; most accessible tissue: Callus, score: 92.093 | N | N | N | N |
| vg0522118727 | TA -> AA | LOC_Os05g37780.1 | upstream_gene_variant ; 4115.0bp to feature; MODIFIER | silent_mutation | Average:62.589; most accessible tissue: Callus, score: 92.093 | N | N | N | N |
| vg0522118727 | TA -> AA | LOC_Os05g37770-LOC_Os05g37780 | intergenic_region ; MODIFIER | silent_mutation | Average:62.589; most accessible tissue: Callus, score: 92.093 | N | N | N | N |
| vg0522118727 | TA -> TAA | LOC_Os05g37780.1 | upstream_gene_variant ; 4113.0bp to feature; MODIFIER | silent_mutation | Average:62.589; most accessible tissue: Callus, score: 92.093 | N | N | N | N |
| vg0522118727 | TA -> TAA | LOC_Os05g37770-LOC_Os05g37780 | intergenic_region ; MODIFIER | silent_mutation | Average:62.589; most accessible tissue: Callus, score: 92.093 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0522118727 | 8.41E-06 | 7.21E-09 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522118727 | 1.78E-06 | 2.38E-09 | mr1757 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522118727 | NA | 4.26E-07 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522118727 | NA | 5.21E-06 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |