\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0522027089:

Variant ID: vg0522027089 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 22027089
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


GTTATAAACTTTTGTGTACACTTGTCCTGAACTTGAAATTATGTGGCCTTCATTTCTCTTTCTTTTTCTAAAATACTGTACCATTTTAAATGCAATTTAG[G/C]
ATGTTAATTTTGTAACCGGGCTAATAAAATAACATTTTTGATATGATAAAATCATGCACTACGAAGAAAGTACATTGTCAGTCATGATGTGAAATGCTGC

Reverse complement sequence

GCAGCATTTCACATCATGACTGACAATGTACTTTCTTCGTAGTGCATGATTTTATCATATCAAAAATGTTATTTTATTAGCCCGGTTACAAAATTAACAT[C/G]
CTAAATTGCATTTAAAATGGTACAGTATTTTAGAAAAAGAAAGAGAAATGAAGGCCACATAATTTCAAGTTCAGGACAAGTGTACACAAAAGTTTATAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.10% 1.30% 0.63% 0.00% NA
All Indica  2759 96.70% 2.20% 1.09% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 91.40% 6.20% 2.35% 0.00% NA
Indica II  465 95.90% 1.90% 2.15% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 97.50% 1.80% 0.76% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0522027089 G -> C LOC_Os05g37630.1 upstream_gene_variant ; 3350.0bp to feature; MODIFIER silent_mutation Average:65.767; most accessible tissue: Callus, score: 84.978 N N N N
vg0522027089 G -> C LOC_Os05g37640.1 upstream_gene_variant ; 2134.0bp to feature; MODIFIER silent_mutation Average:65.767; most accessible tissue: Callus, score: 84.978 N N N N
vg0522027089 G -> C LOC_Os05g37630-LOC_Os05g37640 intergenic_region ; MODIFIER silent_mutation Average:65.767; most accessible tissue: Callus, score: 84.978 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0522027089 2.49E-06 3.03E-12 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522027089 NA 4.81E-06 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522027089 1.26E-07 8.70E-15 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522027089 5.83E-10 1.35E-16 mr1038_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522027089 NA 3.89E-09 mr1141_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0522027089 8.50E-10 4.00E-15 mr1389_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251