\
| Variant ID: vg0522027089 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 22027089 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 277. )
GTTATAAACTTTTGTGTACACTTGTCCTGAACTTGAAATTATGTGGCCTTCATTTCTCTTTCTTTTTCTAAAATACTGTACCATTTTAAATGCAATTTAG[G/C]
ATGTTAATTTTGTAACCGGGCTAATAAAATAACATTTTTGATATGATAAAATCATGCACTACGAAGAAAGTACATTGTCAGTCATGATGTGAAATGCTGC
GCAGCATTTCACATCATGACTGACAATGTACTTTCTTCGTAGTGCATGATTTTATCATATCAAAAATGTTATTTTATTAGCCCGGTTACAAAATTAACAT[C/G]
CTAAATTGCATTTAAAATGGTACAGTATTTTAGAAAAAGAAAGAGAAATGAAGGCCACATAATTTCAAGTTCAGGACAAGTGTACACAAAAGTTTATAAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.10% | 1.30% | 0.63% | 0.00% | NA |
| All Indica | 2759 | 96.70% | 2.20% | 1.09% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.40% | 6.20% | 2.35% | 0.00% | NA |
| Indica II | 465 | 95.90% | 1.90% | 2.15% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.50% | 1.80% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0522027089 | G -> C | LOC_Os05g37630.1 | upstream_gene_variant ; 3350.0bp to feature; MODIFIER | silent_mutation | Average:65.767; most accessible tissue: Callus, score: 84.978 | N | N | N | N |
| vg0522027089 | G -> C | LOC_Os05g37640.1 | upstream_gene_variant ; 2134.0bp to feature; MODIFIER | silent_mutation | Average:65.767; most accessible tissue: Callus, score: 84.978 | N | N | N | N |
| vg0522027089 | G -> C | LOC_Os05g37630-LOC_Os05g37640 | intergenic_region ; MODIFIER | silent_mutation | Average:65.767; most accessible tissue: Callus, score: 84.978 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0522027089 | 2.49E-06 | 3.03E-12 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522027089 | NA | 4.81E-06 | mr1083 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522027089 | 1.26E-07 | 8.70E-15 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522027089 | 5.83E-10 | 1.35E-16 | mr1038_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522027089 | NA | 3.89E-09 | mr1141_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0522027089 | 8.50E-10 | 4.00E-15 | mr1389_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |