Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0521967722:

Variant ID: vg0521967722 (JBrowse)	Variation Type: INDEL
Chromosome: chr05	Position: 21967722
Reference Allele: G	Alternative Allele: A,T,GAA
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

TCTTTCAACTTTTTCGTCATATCGTTCCAATTTCAACTAAACTTTCAATTTTAGCGTGAACATGGGGGTGATGAAAATCTAAATAATTTTTTATCCAGCG[G/A,T,GAA]
AAAAAAAACATAGGAGCAATTATTAAAAGTGGCATTTGGAGAGTGGCAAATAGTTGGATCCCTCATGTGTAACTTGGTACCGTGAGGCATAGATTATAGT

Reverse complement sequence

ACTATAATCTATGCCTCACGGTACCAAGTTACACATGAGGGATCCAACTATTTGCCACTCTCCAAATGCCACTTTTAATAATTGCTCCTATGTTTTTTTT[C/T,A,TTC]
CGCTGGATAAAAAATTATTTAGATTTTCATCACCCCCATGTTCACGCTAAAATTGAAAGTTTAGTTGAAATTGGAACGATATGACGAAAAAGTTGAAAGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.30%	38.50%	0.19%	0.00%	GAA: 0.02%; T: 0.02%
All Indica	2759	97.70%	1.90%	0.33%	0.00%	GAA: 0.04%; T: 0.04%
All Japonica	1512	1.30%	98.70%	0.00%	0.00%	NA
Aus	269	49.40%	50.60%	0.00%	0.00%	NA
Indica I	595	98.70%	1.00%	0.34%	0.00%	NA
Indica II	465	97.80%	1.70%	0.43%	0.00%	NA
Indica III	913	99.10%	0.50%	0.11%	0.00%	T: 0.11%; GAA: 0.11%
Indica Intermediate	786	95.30%	4.20%	0.51%	0.00%	NA
Temperate Japonica	767	1.30%	98.70%	0.00%	0.00%	NA
Tropical Japonica	504	1.00%	99.00%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	97.90%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	50.00%	50.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0521967722	G -> T	LOC_Os05g37520.2	upstream_gene_variant ; 1710.0bp to feature; MODIFIER	silent_mutation	Average:66.452; most accessible tissue: Minghui63 root, score: 78.091	N	N	N	N
vg0521967722	G -> T	LOC_Os05g37530.1	upstream_gene_variant ; 2661.0bp to feature; MODIFIER	silent_mutation	Average:66.452; most accessible tissue: Minghui63 root, score: 78.091	N	N	N	N
vg0521967722	G -> T	LOC_Os05g37520.1	upstream_gene_variant ; 1710.0bp to feature; MODIFIER	silent_mutation	Average:66.452; most accessible tissue: Minghui63 root, score: 78.091	N	N	N	N
vg0521967722	G -> T	LOC_Os05g37520-LOC_Os05g37530	intergenic_region ; MODIFIER	silent_mutation	Average:66.452; most accessible tissue: Minghui63 root, score: 78.091	N	N	N	N
vg0521967722	G -> GAA	LOC_Os05g37520.2	upstream_gene_variant ; 1711.0bp to feature; MODIFIER	silent_mutation	Average:66.452; most accessible tissue: Minghui63 root, score: 78.091	N	N	N	N
vg0521967722	G -> GAA	LOC_Os05g37530.1	upstream_gene_variant ; 2660.0bp to feature; MODIFIER	silent_mutation	Average:66.452; most accessible tissue: Minghui63 root, score: 78.091	N	N	N	N
vg0521967722	G -> GAA	LOC_Os05g37520.1	upstream_gene_variant ; 1711.0bp to feature; MODIFIER	silent_mutation	Average:66.452; most accessible tissue: Minghui63 root, score: 78.091	N	N	N	N
vg0521967722	G -> GAA	LOC_Os05g37520-LOC_Os05g37530	intergenic_region ; MODIFIER	silent_mutation	Average:66.452; most accessible tissue: Minghui63 root, score: 78.091	N	N	N	N
vg0521967722	G -> A	LOC_Os05g37520.2	upstream_gene_variant ; 1710.0bp to feature; MODIFIER	silent_mutation	Average:66.452; most accessible tissue: Minghui63 root, score: 78.091	N	N	N	N
vg0521967722	G -> A	LOC_Os05g37530.1	upstream_gene_variant ; 2661.0bp to feature; MODIFIER	silent_mutation	Average:66.452; most accessible tissue: Minghui63 root, score: 78.091	N	N	N	N
vg0521967722	G -> A	LOC_Os05g37520.1	upstream_gene_variant ; 1710.0bp to feature; MODIFIER	silent_mutation	Average:66.452; most accessible tissue: Minghui63 root, score: 78.091	N	N	N	N
vg0521967722	G -> A	LOC_Os05g37520-LOC_Os05g37530	intergenic_region ; MODIFIER	silent_mutation	Average:66.452; most accessible tissue: Minghui63 root, score: 78.091	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0521967722	NA	7.10E-23	mr1003	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967722	NA	5.17E-67	mr1027	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967722	NA	4.23E-22	mr1051	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967722	2.32E-06	NA	mr1080	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967722	NA	2.10E-53	mr1125	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967722	NA	5.85E-15	mr1156	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967722	NA	4.09E-21	mr1163	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967722	8.80E-06	NA	mr1395	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967722	NA	5.37E-31	mr1448	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967722	NA	6.70E-26	mr1537	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967722	NA	1.10E-66	mr1538	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967722	NA	2.70E-42	mr1591	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967722	NA	5.69E-60	mr1594	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967722	NA	1.31E-08	mr1595	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967722	1.60E-08	8.26E-66	mr1619	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967722	NA	9.07E-28	mr1638	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967722	NA	1.42E-85	mr1718	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967722	NA	9.81E-32	mr1737	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967722	NA	7.00E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967722	NA	2.71E-52	mr1795	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967722	NA	4.10E-36	mr1828	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967722	NA	1.77E-06	mr1850	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967722	NA	1.10E-23	mr1862	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967722	NA	1.19E-22	mr1888	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967722	NA	1.36E-40	mr1890	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967722	NA	9.11E-32	mr1037_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521967722	NA	3.60E-65	mr1125_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251