Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0521957091:

Variant ID: vg0521957091 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 21957091
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, T: 0.09, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

CATGATCCTTTTTTGCCATTACTTTTGTCACTGTATAATTGCGAAAGTTGAGGTATCATATTTATGCAAGCATATAGTACTCATGTCACAAATCCCATAC[A/T]
TTACTATAGAAAGTGGCTACCCTCACACTAGCCAGGCAACAAGATTCTGTGTCTGGGGGGACTGAAACAGTATGAATGGGTCAATGGAATTTGGACCTTT

Reverse complement sequence

AAAGGTCCAAATTCCATTGACCCATTCATACTGTTTCAGTCCCCCCAGACACAGAATCTTGTTGCCTGGCTAGTGTGAGGGTAGCCACTTTCTATAGTAA[T/A]
GTATGGGATTTGTGACATGAGTACTATATGCTTGCATAAATATGATACCTCAACTTTCGCAATTATACAGTGACAAAAGTAATGGCAAAAAAGGATCATG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.50%	38.30%	0.21%	0.04%	NA
All Indica	2759	97.90%	1.70%	0.29%	0.07%	NA
All Japonica	1512	1.30%	98.70%	0.00%	0.00%	NA
Aus	269	50.20%	49.80%	0.00%	0.00%	NA
Indica I	595	99.30%	0.50%	0.17%	0.00%	NA
Indica II	465	97.80%	1.70%	0.22%	0.22%	NA
Indica III	913	99.20%	0.50%	0.22%	0.00%	NA
Indica Intermediate	786	95.40%	3.90%	0.51%	0.13%	NA
Temperate Japonica	767	1.30%	98.70%	0.00%	0.00%	NA
Tropical Japonica	504	1.00%	99.00%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	97.90%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	51.10%	46.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0521957091	A -> T	LOC_Os05g37510.1	upstream_gene_variant ; 4447.0bp to feature; MODIFIER	silent_mutation	Average:62.763; most accessible tissue: Minghui63 flower, score: 77.644	N	N	N	N
vg0521957091	A -> T	LOC_Os05g37500.1	intron_variant ; MODIFIER	silent_mutation	Average:62.763; most accessible tissue: Minghui63 flower, score: 77.644	N	N	N	N
vg0521957091	A -> DEL	N	N	silent_mutation	Average:62.763; most accessible tissue: Minghui63 flower, score: 77.644	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0521957091	NA	2.80E-26	mr1024	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521957091	NA	4.06E-66	mr1027	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521957091	NA	3.47E-49	mr1125	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521957091	4.89E-06	NA	mr1150	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521957091	NA	1.92E-56	mr1594	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521957091	NA	6.50E-09	mr1595	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521957091	NA	5.29E-29	mr1638	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521957091	NA	1.53E-82	mr1718	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521957091	NA	1.79E-29	mr1737	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521957091	NA	9.59E-23	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521957091	NA	7.88E-31	mr1037_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521957091	NA	9.95E-26	mr1051_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521957091	NA	1.04E-57	mr1064_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521957091	NA	1.26E-62	mr1125_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251