\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0521957091:

Variant ID: vg0521957091 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 21957091
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, T: 0.09, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


CATGATCCTTTTTTGCCATTACTTTTGTCACTGTATAATTGCGAAAGTTGAGGTATCATATTTATGCAAGCATATAGTACTCATGTCACAAATCCCATAC[A/T]
TTACTATAGAAAGTGGCTACCCTCACACTAGCCAGGCAACAAGATTCTGTGTCTGGGGGGACTGAAACAGTATGAATGGGTCAATGGAATTTGGACCTTT

Reverse complement sequence

AAAGGTCCAAATTCCATTGACCCATTCATACTGTTTCAGTCCCCCCAGACACAGAATCTTGTTGCCTGGCTAGTGTGAGGGTAGCCACTTTCTATAGTAA[T/A]
GTATGGGATTTGTGACATGAGTACTATATGCTTGCATAAATATGATACCTCAACTTTCGCAATTATACAGTGACAAAAGTAATGGCAAAAAAGGATCATG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.50% 38.30% 0.21% 0.04% NA
All Indica  2759 97.90% 1.70% 0.29% 0.07% NA
All Japonica  1512 1.30% 98.70% 0.00% 0.00% NA
Aus  269 50.20% 49.80% 0.00% 0.00% NA
Indica I  595 99.30% 0.50% 0.17% 0.00% NA
Indica II  465 97.80% 1.70% 0.22% 0.22% NA
Indica III  913 99.20% 0.50% 0.22% 0.00% NA
Indica Intermediate  786 95.40% 3.90% 0.51% 0.13% NA
Temperate Japonica  767 1.30% 98.70% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 51.10% 46.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0521957091 A -> T LOC_Os05g37510.1 upstream_gene_variant ; 4447.0bp to feature; MODIFIER silent_mutation Average:62.763; most accessible tissue: Minghui63 flower, score: 77.644 N N N N
vg0521957091 A -> T LOC_Os05g37500.1 intron_variant ; MODIFIER silent_mutation Average:62.763; most accessible tissue: Minghui63 flower, score: 77.644 N N N N
vg0521957091 A -> DEL N N silent_mutation Average:62.763; most accessible tissue: Minghui63 flower, score: 77.644 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0521957091 NA 2.80E-26 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521957091 NA 4.06E-66 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521957091 NA 3.47E-49 mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521957091 4.89E-06 NA mr1150 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521957091 NA 1.92E-56 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521957091 NA 6.50E-09 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521957091 NA 5.29E-29 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521957091 NA 1.53E-82 mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521957091 NA 1.79E-29 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521957091 NA 9.59E-23 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521957091 NA 7.88E-31 mr1037_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521957091 NA 9.95E-26 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521957091 NA 1.04E-57 mr1064_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521957091 NA 1.26E-62 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251