Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0521872068:

Variant ID: vg0521872068 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 21872068
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:

CAAGGAGCTACAAAGTGTGAGCCAACCTCCCCTTTGTTCTAGCTACCCAATCTGGAAAGAATCCAACCCCCTTTTTAATGGGCCAGGTCCTCCTTTTATA[T/C]
TTCAAGGGGATACCACATGCACCCCTCTCTTTCCAAACTGGACTTTTCTTCTTTTCATAAATGGACGGAGATTTGCACGGTTGCCCTCCGAACATCCTTC

Reverse complement sequence

GAAGGATGTTCGGAGGGCAACCGTGCAAATCTCCGTCCATTTATGAAAAGAAGAAAAGTCCAGTTTGGAAAGAGAGGGGTGCATGTGGTATCCCCTTGAA[A/G]
TATAAAAGGAGGACCTGGCCCATTAAAAAGGGGGTTGGATTCTTTCCAGATTGGGTAGCTAGAACAAAGGGGAGGTTGGCTCACACTTTGTAGCTCCTTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.90%	5.80%	8.91%	42.45%	NA
All Indica	2759	8.50%	9.80%	14.14%	67.56%	NA
All Japonica	1512	99.30%	0.00%	0.33%	0.40%	NA
Aus	269	48.70%	0.70%	8.18%	42.38%	NA
Indica I	595	4.40%	3.20%	10.25%	82.18%	NA
Indica II	465	3.90%	7.50%	13.12%	75.48%	NA
Indica III	913	10.80%	16.30%	17.42%	55.42%	NA
Indica Intermediate	786	11.60%	8.70%	13.87%	65.90%	NA
Temperate Japonica	767	99.20%	0.00%	0.26%	0.52%	NA
Tropical Japonica	504	99.60%	0.00%	0.00%	0.40%	NA
Japonica Intermediate	241	98.80%	0.00%	1.24%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	71.10%	0.00%	4.44%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0521872068	T -> DEL	N	N	silent_mutation	Average:4.546; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0521872068	T -> C	LOC_Os05g37380.1	upstream_gene_variant ; 394.0bp to feature; MODIFIER	silent_mutation	Average:4.546; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0521872068	T -> C	LOC_Os05g37390.1	upstream_gene_variant ; 3869.0bp to feature; MODIFIER	silent_mutation	Average:4.546; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0521872068	T -> C	LOC_Os05g37390.2	upstream_gene_variant ; 3869.0bp to feature; MODIFIER	silent_mutation	Average:4.546; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0521872068	T -> C	LOC_Os05g37380-LOC_Os05g37390	intergenic_region ; MODIFIER	silent_mutation	Average:4.546; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0521872068	1.60E-06	2.88E-06	mr1245_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521872068	1.09E-06	6.00E-07	mr1245_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521872068	1.60E-06	1.60E-06	mr1311_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521872068	5.21E-06	3.75E-06	mr1373_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521872068	3.38E-06	3.38E-06	mr1374_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521872068	NA	7.38E-06	mr1445_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521872068	3.63E-06	1.44E-06	mr1445_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521872068	8.28E-07	8.28E-07	mr1652_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521872068	NA	3.70E-06	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521872068	8.14E-06	2.72E-06	mr1669_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521872068	3.09E-06	3.09E-06	mr1674_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521872068	9.88E-07	9.88E-07	mr1688_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521872068	3.74E-06	3.74E-06	mr1697_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521872068	3.31E-06	3.31E-06	mr1822_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521872068	6.47E-06	6.47E-06	mr1843_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251