Search for Variation information by Variation ID:
Detailed information for vg0521870267:
| Variant ID: vg0521870267 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 21870267 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, T: 0.15, others allele: 0.00, population size: 66. )
Flanking Sequence (100 bp) in Reference Genome:
TCCTCCCACTTCCTCGTCCGCTCAGCCAAACTTTTGACTGCACGGCAGTCCGCGAGGTCGTGAAGGGAAGTGTTGTGGACGGTGCACCACTTGCCGGTGG[G/T]
GCGCTCCCTGCTGGGAGCGCTGGCCTCCTTCTTCTTGTCGCTCGCAGGCCTCCCCTTTCGGGTGGCCCGCGAAGCGCCCTCGACGGCGAGGACATGACCC
Reverse complement sequence
GGGTCATGTCCTCGCCGTCGAGGGCGCTTCGCGGGCCACCCGAAAGGGGAGGCCTGCGAGCGACAAGAAGAAGGAGGCCAGCGCTCCCAGCAGGGAGCGC[C/A]
CCACCGGCAAGTGGTGCACCGTCCACAACACTTCCCTTCACGACCTCGCGGACTGCCGTGCAGTCAAAAGTTTGGCTGAGCGGACGAGGAAGTGGGAGGA
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.30% | 5.10% | 6.77% | 46.83% | NA |
| All Indica | 2759 | 6.20% | 8.60% | 10.29% | 74.92% | NA |
| All Japonica | 1512 | 99.10% | 0.00% | 0.20% | 0.66% | NA |
| Aus | 269 | 46.50% | 0.70% | 11.90% | 40.89% | NA |
| Indica I | 595 | 4.00% | 1.50% | 5.71% | 88.74% | NA |
| Indica II | 465 | 6.50% | 4.70% | 4.52% | 84.30% | NA |
| Indica III | 913 | 4.50% | 16.40% | 16.32% | 62.76% | NA |
| Indica Intermediate | 786 | 9.70% | 7.10% | 10.18% | 73.03% | NA |
| Temperate Japonica | 767 | 99.10% | 0.00% | 0.00% | 0.91% | NA |
| Tropical Japonica | 504 | 99.40% | 0.00% | 0.20% | 0.40% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.83% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 0.00% | 1.11% | 28.89% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0521870267 | G -> T | LOC_Os05g37380.1 | missense_variant ; p.Pro435Thr; MODERATE | nonsynonymous_codon ; P435T | Average:9.784; most accessible tissue: Minghui63 young leaf, score: 18.03 | possibly damaging  |
1.567 |
DELETERIOUS | 0.00 |
| vg0521870267 | G -> DEL | LOC_Os05g37380.1 | N | frameshift_variant | Average:9.784; most accessible tissue: Minghui63 young leaf, score: 18.03 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0521870267 | 8.31E-06 | 4.62E-09 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521870267 | 7.64E-06 | 6.40E-09 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521870267 | NA | 2.03E-09 | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521870267 | 2.05E-09 | 2.05E-09 | mr1900 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521870267 | NA | 3.07E-09 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521870267 | NA | 9.02E-08 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521870267 | NA | 5.09E-09 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521870267 | NA | 1.64E-07 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |