Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0521861498:

Variant ID: vg0521861498 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 21861498
Reference Allele: C	Alternative Allele: T,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:

ATTAATTAGGAATAGTTTGTTAGTTTCCTTTTATCTTTAGGAAGGTGTGTTTAGTGTCCGATAAGGAATTTATGTTTTCCTTTTATCTTTAGGTTAGTTT[C/T,A]
TTTCTTGTCCGACAAGGACTTGTATCAACCCATGGGTATAAATATGTACACCCGGGGTCTATGTAATCTATCTCCACGATCAATACAATTCGGCGCATCG

Reverse complement sequence

CGATGCGCCGAATTGTATTGATCGTGGAGATAGATTACATAGACCCCGGGTGTACATATTTATACCCATGGGTTGATACAAGTCCTTGTCGGACAAGAAA[G/A,T]
AAACTAACCTAAAGATAAAAGGAAAACATAAATTCCTTATCGGACACTAAACACACCTTCCTAAAGATAAAAGGAAACTAACAAACTATTCCTAATTAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.70%	21.10%	0.15%	0.02%	A: 0.02%
All Indica	2759	64.20%	35.60%	0.18%	0.04%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	98.50%	0.40%	0.74%	0.00%	A: 0.37%
Indica I	595	46.90%	52.60%	0.34%	0.17%	NA
Indica II	465	86.90%	13.10%	0.00%	0.00%	NA
Indica III	913	57.10%	42.70%	0.22%	0.00%	NA
Indica Intermediate	786	72.10%	27.70%	0.13%	0.00%	NA
Temperate Japonica	767	99.20%	0.80%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0521861498	C -> T	LOC_Os05g37360.1	upstream_gene_variant ; 3303.0bp to feature; MODIFIER	silent_mutation	Average:34.961; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0521861498	C -> T	LOC_Os05g37370.1	upstream_gene_variant ; 2922.0bp to feature; MODIFIER	silent_mutation	Average:34.961; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0521861498	C -> T	LOC_Os05g37380.1	downstream_gene_variant ; 4021.0bp to feature; MODIFIER	silent_mutation	Average:34.961; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0521861498	C -> T	LOC_Os05g37360-LOC_Os05g37370	intergenic_region ; MODIFIER	silent_mutation	Average:34.961; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0521861498	C -> DEL	N	N	silent_mutation	Average:34.961; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0521861498	C -> A	LOC_Os05g37360.1	upstream_gene_variant ; 3303.0bp to feature; MODIFIER	silent_mutation	Average:34.961; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0521861498	C -> A	LOC_Os05g37370.1	upstream_gene_variant ; 2922.0bp to feature; MODIFIER	silent_mutation	Average:34.961; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0521861498	C -> A	LOC_Os05g37380.1	downstream_gene_variant ; 4021.0bp to feature; MODIFIER	silent_mutation	Average:34.961; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0521861498	C -> A	LOC_Os05g37360-LOC_Os05g37370	intergenic_region ; MODIFIER	silent_mutation	Average:34.961; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0521861498	NA	2.47E-06	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498	NA	2.44E-08	mr1044	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498	NA	3.02E-07	mr1044	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498	NA	5.12E-08	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498	NA	3.15E-06	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498	NA	1.95E-07	mr1115	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498	NA	2.66E-11	mr1195	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498	NA	5.52E-06	mr1195	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498	NA	1.99E-06	mr1352	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498	NA	4.48E-06	mr1469	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498	NA	4.33E-07	mr1517	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498	NA	4.67E-06	mr1528	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498	NA	5.70E-06	mr1547	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498	NA	7.79E-06	mr1611	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498	NA	7.19E-06	mr1614	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498	NA	3.58E-06	mr1671	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498	NA	2.51E-08	mr1716	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498	NA	1.68E-06	mr1735	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498	NA	2.47E-06	mr1735	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498	3.39E-06	NA	mr1737	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498	3.75E-06	4.17E-07	mr1737	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498	NA	7.38E-06	mr1759	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498	NA	6.91E-06	mr1771	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498	NA	1.00E-06	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498	NA	8.21E-06	mr1788	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498	9.56E-07	9.51E-07	mr1856	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498	NA	3.89E-06	mr1856	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498	NA	3.63E-07	mr1925	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498	NA	5.98E-06	mr1982	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498	5.81E-06	5.80E-06	mr1992	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498	NA	5.09E-06	mr1415_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498	NA	6.94E-07	mr1517_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498	NA	6.35E-08	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251