\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0521861498:

Variant ID: vg0521861498 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 21861498
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


ATTAATTAGGAATAGTTTGTTAGTTTCCTTTTATCTTTAGGAAGGTGTGTTTAGTGTCCGATAAGGAATTTATGTTTTCCTTTTATCTTTAGGTTAGTTT[C/T,A]
TTTCTTGTCCGACAAGGACTTGTATCAACCCATGGGTATAAATATGTACACCCGGGGTCTATGTAATCTATCTCCACGATCAATACAATTCGGCGCATCG

Reverse complement sequence

CGATGCGCCGAATTGTATTGATCGTGGAGATAGATTACATAGACCCCGGGTGTACATATTTATACCCATGGGTTGATACAAGTCCTTGTCGGACAAGAAA[G/A,T]
AAACTAACCTAAAGATAAAAGGAAAACATAAATTCCTTATCGGACACTAAACACACCTTCCTAAAGATAAAAGGAAACTAACAAACTATTCCTAATTAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.70% 21.10% 0.15% 0.02% A: 0.02%
All Indica  2759 64.20% 35.60% 0.18% 0.04% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 98.50% 0.40% 0.74% 0.00% A: 0.37%
Indica I  595 46.90% 52.60% 0.34% 0.17% NA
Indica II  465 86.90% 13.10% 0.00% 0.00% NA
Indica III  913 57.10% 42.70% 0.22% 0.00% NA
Indica Intermediate  786 72.10% 27.70% 0.13% 0.00% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0521861498 C -> T LOC_Os05g37360.1 upstream_gene_variant ; 3303.0bp to feature; MODIFIER silent_mutation Average:34.961; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0521861498 C -> T LOC_Os05g37370.1 upstream_gene_variant ; 2922.0bp to feature; MODIFIER silent_mutation Average:34.961; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0521861498 C -> T LOC_Os05g37380.1 downstream_gene_variant ; 4021.0bp to feature; MODIFIER silent_mutation Average:34.961; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0521861498 C -> T LOC_Os05g37360-LOC_Os05g37370 intergenic_region ; MODIFIER silent_mutation Average:34.961; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0521861498 C -> DEL N N silent_mutation Average:34.961; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0521861498 C -> A LOC_Os05g37360.1 upstream_gene_variant ; 3303.0bp to feature; MODIFIER silent_mutation Average:34.961; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0521861498 C -> A LOC_Os05g37370.1 upstream_gene_variant ; 2922.0bp to feature; MODIFIER silent_mutation Average:34.961; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0521861498 C -> A LOC_Os05g37380.1 downstream_gene_variant ; 4021.0bp to feature; MODIFIER silent_mutation Average:34.961; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0521861498 C -> A LOC_Os05g37360-LOC_Os05g37370 intergenic_region ; MODIFIER silent_mutation Average:34.961; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0521861498 NA 2.47E-06 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498 NA 2.44E-08 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498 NA 3.02E-07 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498 NA 5.12E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498 NA 3.15E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498 NA 1.95E-07 mr1115 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498 NA 2.66E-11 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498 NA 5.52E-06 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498 NA 1.99E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498 NA 4.48E-06 mr1469 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498 NA 4.33E-07 mr1517 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498 NA 4.67E-06 mr1528 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498 NA 5.70E-06 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498 NA 7.79E-06 mr1611 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498 NA 7.19E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498 NA 3.58E-06 mr1671 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498 NA 2.51E-08 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498 NA 1.68E-06 mr1735 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498 NA 2.47E-06 mr1735 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498 3.39E-06 NA mr1737 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498 3.75E-06 4.17E-07 mr1737 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498 NA 7.38E-06 mr1759 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498 NA 6.91E-06 mr1771 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498 NA 1.00E-06 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498 NA 8.21E-06 mr1788 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498 9.56E-07 9.51E-07 mr1856 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498 NA 3.89E-06 mr1856 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498 NA 3.63E-07 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498 NA 5.98E-06 mr1982 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498 5.81E-06 5.80E-06 mr1992 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498 NA 5.09E-06 mr1415_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498 NA 6.94E-07 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521861498 NA 6.35E-08 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251