\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0521767607:

Variant ID: vg0521767607 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 21767607
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.72, T: 0.28, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


TCCCGTTTTTCTTTTTTTTTTTTTGATAATTTGGTCCTTTTAAAAAATTTATTTTGAAACTAATCCTCGTCAAAAACTTCAACCAAAAATAGGCCGTGGG[T/C]
TCAGCGCCAATTCCGTTGACGCTGAACCCTTGCCCACGTGGATCAACAGTTGATCGGATTGCCGACGTAGCGTAGGGTCAGCGCCAATGCATTTGGCGCT

Reverse complement sequence

AGCGCCAAATGCATTGGCGCTGACCCTACGCTACGTCGGCAATCCGATCAACTGTTGATCCACGTGGGCAAGGGTTCAGCGTCAACGGAATTGGCGCTGA[A/G]
CCCACGGCCTATTTTTGGTTGAAGTTTTTGACGAGGATTAGTTTCAAAATAAATTTTTTAAAAGGACCAAATTATCAAAAAAAAAAAAAGAAAAACGGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.10% 35.30% 13.58% 10.01% NA
All Indica  2759 60.30% 1.70% 21.78% 16.27% NA
All Japonica  1512 6.40% 93.30% 0.20% 0.13% NA
Aus  269 52.80% 31.60% 9.29% 6.32% NA
Indica I  595 54.50% 0.50% 35.29% 9.75% NA
Indica II  465 53.80% 1.90% 23.66% 20.65% NA
Indica III  913 67.60% 0.40% 13.47% 18.51% NA
Indica Intermediate  786 60.10% 3.80% 20.10% 16.03% NA
Temperate Japonica  767 0.90% 98.70% 0.13% 0.26% NA
Tropical Japonica  504 17.10% 82.70% 0.20% 0.00% NA
Japonica Intermediate  241 1.70% 97.90% 0.41% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 42.20% 37.80% 14.44% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0521767607 T -> DEL N N silent_mutation Average:96.405; most accessible tissue: Minghui63 panicle, score: 98.854 N N N N
vg0521767607 T -> C LOC_Os05g37225.1 upstream_gene_variant ; 4867.0bp to feature; MODIFIER silent_mutation Average:96.405; most accessible tissue: Minghui63 panicle, score: 98.854 N N N N
vg0521767607 T -> C LOC_Os05g37225-LOC_Os05g37230 intergenic_region ; MODIFIER silent_mutation Average:96.405; most accessible tissue: Minghui63 panicle, score: 98.854 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0521767607 T C 0.0 0.0 -0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0521767607 NA 3.73E-66 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521767607 NA 1.42E-28 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521767607 NA 4.84E-43 mr1124 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521767607 NA 2.92E-42 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521767607 NA 1.46E-08 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521767607 NA 3.63E-07 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521767607 NA 3.61E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521767607 NA 3.32E-31 mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521767607 NA 9.40E-16 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521767607 NA 2.62E-06 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521767607 NA 6.92E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521767607 NA 4.81E-16 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521767607 NA 9.89E-21 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521767607 NA 3.92E-26 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521767607 NA 1.95E-62 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521767607 NA 6.77E-08 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521767607 NA 1.91E-53 mr1136_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521767607 NA 9.66E-12 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521767607 6.72E-06 1.82E-10 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521767607 NA 5.30E-08 mr1218_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521767607 NA 7.19E-37 mr1689_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521767607 NA 6.98E-32 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521767607 2.08E-06 NA mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251