\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0521749407:

Variant ID: vg0521749407 (JBrowse)Variation Type: INDEL
Chromosome: chr05Position: 21749407
Reference Allele: TAlternative Allele: G,TAG,TAGAG
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGTGCTAGTTAATTTTATGCATGCATGCACGCCTTATATTATGAAACATCTAAAAAATAGTTGTGTCTTATATTATGAAATAAAGGGAGTAACTTGAGA[T/G,TAG,TAGAG]
AGAGAGAGAGGAGGGGTGAGTGGTGAAGGAAGAAGTGAGGTTTTCATTTACATGTAGGGTCTATCTATAATTTTTTAATTTCTTTGTTGATTAGGCTGTC

Reverse complement sequence

GACAGCCTAATCAACAAAGAAATTAAAAAATTATAGATAGACCCTACATGTAAATGAAAACCTCACTTCTTCCTTCACCACTCACCCCTCCTCTCTCTCT[A/C,CTA,CTCTA]
TCTCAAGTTACTCCCTTTATTTCATAATATAAGACACAACTATTTTTTAGATGTTTCATAATATAAGGCGTGCATGCATGCATAAAATTAACTAGCACAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.60% 36.10% 0.32% 0.44% TAG: 20.36%; TAGAG: 0.11%
All Indica  2759 63.80% 1.80% 0.33% 0.69% TAG: 33.38%
All Japonica  1512 6.20% 92.80% 0.07% 0.00% TAG: 0.66%; TAGAG: 0.33%
Aus  269 43.50% 50.20% 0.37% 0.00% TAG: 5.95%
Indica I  595 45.40% 0.80% 0.34% 0.34% TAG: 53.11%
Indica II  465 88.60% 1.70% 0.43% 0.86% TAG: 8.39%
Indica III  913 57.70% 0.70% 0.00% 0.88% TAG: 40.74%
Indica Intermediate  786 70.10% 3.90% 0.64% 0.64% TAG: 24.68%
Temperate Japonica  767 1.00% 98.20% 0.13% 0.00% TAG: 0.39%; TAGAG: 0.26%
Tropical Japonica  504 16.50% 82.50% 0.00% 0.00% TAG: 0.79%; TAGAG: 0.20%
Japonica Intermediate  241 0.80% 97.10% 0.00% 0.00% TAG: 1.24%; TAGAG: 0.83%
VI/Aromatic  96 2.10% 93.80% 1.04% 0.00% TAG: 3.12%
Intermediate  90 47.80% 33.30% 3.33% 2.22% TAG: 13.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0521749407 T -> DEL N N silent_mutation Average:85.497; most accessible tissue: Zhenshan97 flower, score: 96.688 N N N N
vg0521749407 T -> G LOC_Os05g37200.1 upstream_gene_variant ; 1294.0bp to feature; MODIFIER silent_mutation Average:85.497; most accessible tissue: Zhenshan97 flower, score: 96.688 N N N N
vg0521749407 T -> G LOC_Os05g37200.3 upstream_gene_variant ; 1294.0bp to feature; MODIFIER silent_mutation Average:85.497; most accessible tissue: Zhenshan97 flower, score: 96.688 N N N N
vg0521749407 T -> G LOC_Os05g37200.2 upstream_gene_variant ; 1294.0bp to feature; MODIFIER silent_mutation Average:85.497; most accessible tissue: Zhenshan97 flower, score: 96.688 N N N N
vg0521749407 T -> G LOC_Os05g37190-LOC_Os05g37200 intergenic_region ; MODIFIER silent_mutation Average:85.497; most accessible tissue: Zhenshan97 flower, score: 96.688 N N N N
vg0521749407 T -> TAGAG LOC_Os05g37200.1 upstream_gene_variant ; 1293.0bp to feature; MODIFIER silent_mutation Average:85.497; most accessible tissue: Zhenshan97 flower, score: 96.688 N N N N
vg0521749407 T -> TAGAG LOC_Os05g37200.3 upstream_gene_variant ; 1293.0bp to feature; MODIFIER silent_mutation Average:85.497; most accessible tissue: Zhenshan97 flower, score: 96.688 N N N N
vg0521749407 T -> TAGAG LOC_Os05g37200.2 upstream_gene_variant ; 1293.0bp to feature; MODIFIER silent_mutation Average:85.497; most accessible tissue: Zhenshan97 flower, score: 96.688 N N N N
vg0521749407 T -> TAGAG LOC_Os05g37190-LOC_Os05g37200 intergenic_region ; MODIFIER silent_mutation Average:85.497; most accessible tissue: Zhenshan97 flower, score: 96.688 N N N N
vg0521749407 T -> TAG LOC_Os05g37200.1 upstream_gene_variant ; 1293.0bp to feature; MODIFIER silent_mutation Average:85.497; most accessible tissue: Zhenshan97 flower, score: 96.688 N N N N
vg0521749407 T -> TAG LOC_Os05g37200.3 upstream_gene_variant ; 1293.0bp to feature; MODIFIER silent_mutation Average:85.497; most accessible tissue: Zhenshan97 flower, score: 96.688 N N N N
vg0521749407 T -> TAG LOC_Os05g37200.2 upstream_gene_variant ; 1293.0bp to feature; MODIFIER silent_mutation Average:85.497; most accessible tissue: Zhenshan97 flower, score: 96.688 N N N N
vg0521749407 T -> TAG LOC_Os05g37190-LOC_Os05g37200 intergenic_region ; MODIFIER silent_mutation Average:85.497; most accessible tissue: Zhenshan97 flower, score: 96.688 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0521749407 T G 0.01 0.01 0.01 0.02 0.01 0.0
vg0521749407 T TAG -0.05 -0.18 -0.11 0.06 0.01 0.0
vg0521749407 T TAGAG 0.07 -0.08 -0.04 0.0 0.06 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0521749407 NA 1.90E-06 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407 NA 3.14E-07 mr1115 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407 NA 3.92E-07 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407 NA 7.51E-06 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407 NA 3.35E-06 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407 NA 3.47E-06 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407 NA 3.83E-06 mr1277 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407 NA 2.92E-11 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407 NA 1.16E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407 NA 6.29E-12 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407 NA 1.10E-06 mr1611 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407 NA 2.33E-08 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407 NA 1.73E-06 mr1624 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407 NA 1.89E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407 NA 4.89E-08 mr1735 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407 NA 9.88E-08 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407 NA 6.25E-06 mr1771 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407 NA 3.03E-06 mr1788 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407 NA 5.71E-06 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407 NA 1.94E-06 mr1921 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407 NA 3.59E-06 mr1992 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407 NA 2.12E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407 NA 1.63E-07 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407 NA 1.48E-08 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407 NA 1.74E-07 mr1218_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407 NA 2.98E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407 NA 3.43E-06 mr1304_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407 NA 1.11E-06 mr1403_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407 NA 2.23E-06 mr1415_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407 NA 2.57E-08 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407 NA 3.92E-14 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521749407 NA 5.80E-09 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251