\
| Variant ID: vg0521727029 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 21727029 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 117. )
TTCGTCTTATTCAAAAACTTTTGTGAAATATATAAAACTATATGTATACATAAAAGTATATTTAACAATAAATTAAATGGTAGGAAAAGAATTAATAATT[G/A]
CTTAAATTTTTTGAATAAGACGAATGGACAAACATGTTTAAAAAAGTTAACGGCGTTAAATATTTAAGGATGGAGGGAGTATATATTCCATTTTCGCAGA
TCTGCGAAAATGGAATATATACTCCCTCCATCCTTAAATATTTAACGCCGTTAACTTTTTTAAACATGTTTGTCCATTCGTCTTATTCAAAAAATTTAAG[C/T]
AATTATTAATTCTTTTCCTACCATTTAATTTATTGTTAAATATACTTTTATGTATACATATAGTTTTATATATTTCACAAAAGTTTTTGAATAAGACGAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.00% | 10.70% | 1.97% | 2.33% | NA |
| All Indica | 2759 | 75.30% | 17.70% | 3.12% | 3.88% | NA |
| All Japonica | 1512 | 99.40% | 0.50% | 0.07% | 0.00% | NA |
| Aus | 269 | 98.50% | 0.00% | 1.12% | 0.37% | NA |
| Indica I | 595 | 89.60% | 5.50% | 4.54% | 0.34% | NA |
| Indica II | 465 | 69.50% | 19.80% | 3.87% | 6.88% | NA |
| Indica III | 913 | 72.60% | 21.70% | 1.31% | 4.38% | NA |
| Indica Intermediate | 786 | 71.00% | 21.10% | 3.69% | 4.20% | NA |
| Temperate Japonica | 767 | 99.10% | 0.80% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 7.80% | 3.33% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0521727029 | G -> DEL | N | N | silent_mutation | Average:63.163; most accessible tissue: Minghui63 root, score: 83.939 | N | N | N | N |
| vg0521727029 | G -> A | LOC_Os05g37180.1 | upstream_gene_variant ; 3876.0bp to feature; MODIFIER | silent_mutation | Average:63.163; most accessible tissue: Minghui63 root, score: 83.939 | N | N | N | N |
| vg0521727029 | G -> A | LOC_Os05g37170.1 | downstream_gene_variant ; 2539.0bp to feature; MODIFIER | silent_mutation | Average:63.163; most accessible tissue: Minghui63 root, score: 83.939 | N | N | N | N |
| vg0521727029 | G -> A | LOC_Os05g37170.5 | downstream_gene_variant ; 2539.0bp to feature; MODIFIER | silent_mutation | Average:63.163; most accessible tissue: Minghui63 root, score: 83.939 | N | N | N | N |
| vg0521727029 | G -> A | LOC_Os05g37170.4 | downstream_gene_variant ; 2464.0bp to feature; MODIFIER | silent_mutation | Average:63.163; most accessible tissue: Minghui63 root, score: 83.939 | N | N | N | N |
| vg0521727029 | G -> A | LOC_Os05g37170.3 | downstream_gene_variant ; 2539.0bp to feature; MODIFIER | silent_mutation | Average:63.163; most accessible tissue: Minghui63 root, score: 83.939 | N | N | N | N |
| vg0521727029 | G -> A | LOC_Os05g37170.2 | downstream_gene_variant ; 2464.0bp to feature; MODIFIER | silent_mutation | Average:63.163; most accessible tissue: Minghui63 root, score: 83.939 | N | N | N | N |
| vg0521727029 | G -> A | LOC_Os05g37170.8 | downstream_gene_variant ; 2539.0bp to feature; MODIFIER | silent_mutation | Average:63.163; most accessible tissue: Minghui63 root, score: 83.939 | N | N | N | N |
| vg0521727029 | G -> A | LOC_Os05g37170.6 | downstream_gene_variant ; 2539.0bp to feature; MODIFIER | silent_mutation | Average:63.163; most accessible tissue: Minghui63 root, score: 83.939 | N | N | N | N |
| vg0521727029 | G -> A | LOC_Os05g37170-LOC_Os05g37180 | intergenic_region ; MODIFIER | silent_mutation | Average:63.163; most accessible tissue: Minghui63 root, score: 83.939 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0521727029 | NA | 3.30E-06 | mr1029 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521727029 | 1.63E-06 | 1.63E-06 | mr1321 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521727029 | 6.89E-06 | NA | mr1322 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521727029 | 6.81E-07 | 6.81E-07 | mr1338 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521727029 | 8.95E-06 | 3.17E-06 | mr1346 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521727029 | NA | 1.88E-06 | mr1378 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521727029 | NA | 4.09E-06 | mr1439 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521727029 | 9.76E-06 | 9.76E-06 | mr1545 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521727029 | NA | 5.87E-07 | mr1625 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521727029 | 1.11E-06 | 1.11E-06 | mr1782 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |