\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0521727029:

Variant ID: vg0521727029 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 21727029
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TTCGTCTTATTCAAAAACTTTTGTGAAATATATAAAACTATATGTATACATAAAAGTATATTTAACAATAAATTAAATGGTAGGAAAAGAATTAATAATT[G/A]
CTTAAATTTTTTGAATAAGACGAATGGACAAACATGTTTAAAAAAGTTAACGGCGTTAAATATTTAAGGATGGAGGGAGTATATATTCCATTTTCGCAGA

Reverse complement sequence

TCTGCGAAAATGGAATATATACTCCCTCCATCCTTAAATATTTAACGCCGTTAACTTTTTTAAACATGTTTGTCCATTCGTCTTATTCAAAAAATTTAAG[C/T]
AATTATTAATTCTTTTCCTACCATTTAATTTATTGTTAAATATACTTTTATGTATACATATAGTTTTATATATTTCACAAAAGTTTTTGAATAAGACGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.00% 10.70% 1.97% 2.33% NA
All Indica  2759 75.30% 17.70% 3.12% 3.88% NA
All Japonica  1512 99.40% 0.50% 0.07% 0.00% NA
Aus  269 98.50% 0.00% 1.12% 0.37% NA
Indica I  595 89.60% 5.50% 4.54% 0.34% NA
Indica II  465 69.50% 19.80% 3.87% 6.88% NA
Indica III  913 72.60% 21.70% 1.31% 4.38% NA
Indica Intermediate  786 71.00% 21.10% 3.69% 4.20% NA
Temperate Japonica  767 99.10% 0.80% 0.13% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 7.80% 3.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0521727029 G -> DEL N N silent_mutation Average:63.163; most accessible tissue: Minghui63 root, score: 83.939 N N N N
vg0521727029 G -> A LOC_Os05g37180.1 upstream_gene_variant ; 3876.0bp to feature; MODIFIER silent_mutation Average:63.163; most accessible tissue: Minghui63 root, score: 83.939 N N N N
vg0521727029 G -> A LOC_Os05g37170.1 downstream_gene_variant ; 2539.0bp to feature; MODIFIER silent_mutation Average:63.163; most accessible tissue: Minghui63 root, score: 83.939 N N N N
vg0521727029 G -> A LOC_Os05g37170.5 downstream_gene_variant ; 2539.0bp to feature; MODIFIER silent_mutation Average:63.163; most accessible tissue: Minghui63 root, score: 83.939 N N N N
vg0521727029 G -> A LOC_Os05g37170.4 downstream_gene_variant ; 2464.0bp to feature; MODIFIER silent_mutation Average:63.163; most accessible tissue: Minghui63 root, score: 83.939 N N N N
vg0521727029 G -> A LOC_Os05g37170.3 downstream_gene_variant ; 2539.0bp to feature; MODIFIER silent_mutation Average:63.163; most accessible tissue: Minghui63 root, score: 83.939 N N N N
vg0521727029 G -> A LOC_Os05g37170.2 downstream_gene_variant ; 2464.0bp to feature; MODIFIER silent_mutation Average:63.163; most accessible tissue: Minghui63 root, score: 83.939 N N N N
vg0521727029 G -> A LOC_Os05g37170.8 downstream_gene_variant ; 2539.0bp to feature; MODIFIER silent_mutation Average:63.163; most accessible tissue: Minghui63 root, score: 83.939 N N N N
vg0521727029 G -> A LOC_Os05g37170.6 downstream_gene_variant ; 2539.0bp to feature; MODIFIER silent_mutation Average:63.163; most accessible tissue: Minghui63 root, score: 83.939 N N N N
vg0521727029 G -> A LOC_Os05g37170-LOC_Os05g37180 intergenic_region ; MODIFIER silent_mutation Average:63.163; most accessible tissue: Minghui63 root, score: 83.939 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0521727029 NA 3.30E-06 mr1029 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521727029 1.63E-06 1.63E-06 mr1321 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521727029 6.89E-06 NA mr1322 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521727029 6.81E-07 6.81E-07 mr1338 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521727029 8.95E-06 3.17E-06 mr1346 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521727029 NA 1.88E-06 mr1378 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521727029 NA 4.09E-06 mr1439 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521727029 9.76E-06 9.76E-06 mr1545 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521727029 NA 5.87E-07 mr1625 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521727029 1.11E-06 1.11E-06 mr1782 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251