Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0521716669:

Variant ID: vg0521716669 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 21716669
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.76, C: 0.23, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


GGGTCCGTATATCACAAAGAAGCATGCCATTCATGGTGCTCGTTGAGTCTAGCAAGCATTTGAATAGCACAAGATGGTACTCACTCCGTTTCAAAATATA[T/C]
GGTGTATTTTGATTCGTTAGGATAATACTTTGACCAACAACTACTCTATTAGAATATCATTTATGTGATATAAAATTATAATCATAAGTAATTTTGAATA

Reverse complement sequence

TATTCAAAATTACTTATGATTATAATTTTATATCACATAAATGATATTCTAATAGAGTAGTTGTTGGTCAAAGTATTATCCTAACGAATCAAAATACACC[A/G]
TATATTTTGAAACGGAGTGAGTACCATCTTGTGCTATTCAAATGCTTGCTAGACTCAACGAGCACCATGAATGGCATGCTTCTTTGTGATATACGGACCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.10% 36.60% 0.06% 0.23% NA
All Indica  2759 98.40% 1.30% 0.07% 0.22% NA
All Japonica  1512 6.50% 93.30% 0.00% 0.26% NA
Aus  269 43.10% 56.90% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 97.20% 2.60% 0.22% 0.00% NA
Indica III  913 99.50% 0.30% 0.00% 0.22% NA
Indica Intermediate  786 96.80% 2.50% 0.13% 0.51% NA
Temperate Japonica  767 1.40% 98.40% 0.00% 0.13% NA
Tropical Japonica  504 16.50% 83.30% 0.00% 0.20% NA
Japonica Intermediate  241 1.70% 97.50% 0.00% 0.83% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 57.80% 40.00% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0521716669 T -> DEL N N silent_mutation Average:75.927; most accessible tissue: Minghui63 panicle, score: 94.033 N N N N
vg0521716669 T -> C LOC_Os05g37150.2 upstream_gene_variant ; 4992.0bp to feature; MODIFIER silent_mutation Average:75.927; most accessible tissue: Minghui63 panicle, score: 94.033 N N N N
vg0521716669 T -> C LOC_Os05g37160.1 upstream_gene_variant ; 1015.0bp to feature; MODIFIER silent_mutation Average:75.927; most accessible tissue: Minghui63 panicle, score: 94.033 N N N N
vg0521716669 T -> C LOC_Os05g37170.1 upstream_gene_variant ; 3014.0bp to feature; MODIFIER silent_mutation Average:75.927; most accessible tissue: Minghui63 panicle, score: 94.033 N N N N
vg0521716669 T -> C LOC_Os05g37170.2 upstream_gene_variant ; 2080.0bp to feature; MODIFIER silent_mutation Average:75.927; most accessible tissue: Minghui63 panicle, score: 94.033 N N N N
vg0521716669 T -> C LOC_Os05g37170.8 upstream_gene_variant ; 3985.0bp to feature; MODIFIER silent_mutation Average:75.927; most accessible tissue: Minghui63 panicle, score: 94.033 N N N N
vg0521716669 T -> C LOC_Os05g37170.6 upstream_gene_variant ; 4076.0bp to feature; MODIFIER silent_mutation Average:75.927; most accessible tissue: Minghui63 panicle, score: 94.033 N N N N
vg0521716669 T -> C LOC_Os05g37170.5 intron_variant ; MODIFIER silent_mutation Average:75.927; most accessible tissue: Minghui63 panicle, score: 94.033 N N N N
vg0521716669 T -> C LOC_Os05g37170.4 intron_variant ; MODIFIER silent_mutation Average:75.927; most accessible tissue: Minghui63 panicle, score: 94.033 N N N N
vg0521716669 T -> C LOC_Os05g37170.3 intron_variant ; MODIFIER silent_mutation Average:75.927; most accessible tissue: Minghui63 panicle, score: 94.033 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0521716669 T C 0.01 0.0 0.0 0.04 0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0521716669 NA 2.06E-51 mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521716669 NA 3.92E-07 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521716669 NA 7.51E-06 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521716669 NA 1.36E-14 mr1218 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521716669 NA 3.35E-06 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521716669 NA 1.31E-31 mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521716669 NA 2.67E-07 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521716669 NA 1.34E-28 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521716669 NA 9.85E-74 mr1125_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521716669 NA 1.63E-07 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521716669 NA 1.48E-08 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521716669 NA 1.74E-07 mr1218_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521716669 NA 3.41E-07 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521716669 NA 6.14E-58 mr1526_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251