Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0521659473:

Variant ID: vg0521659473 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 21659473
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.68, C: 0.33, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTTTTGAAAACCGAAGCCAGCAAAGCTAGTGTTATATTAAGTACGGGAGGAAAAAGTATTTACAAGATAACCAAAAGGAAGAAAGTACGAATTACCCC[T/C]
GAACTATCACGGTTATCCGAATTATTCCCCTGAATCACAAAACCGGACATTTTTCACACCCAATTATGTAAACCGGACGAATTACCCCTCTGATCCAATC

Reverse complement sequence

GATTGGATCAGAGGGGTAATTCGTCCGGTTTACATAATTGGGTGTGAAAAATGTCCGGTTTTGTGATTCAGGGGAATAATTCGGATAACCGTGATAGTTC[A/G]
GGGGTAATTCGTACTTTCTTCCTTTTGGTTATCTTGTAAATACTTTTTCCTCCCGTACTTAATATAACACTAGCTTTGCTGGCTTCGGTTTTCAAAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.50%	35.50%	9.97%	6.03%	NA
All Indica	2759	72.60%	1.40%	15.91%	10.00%	NA
All Japonica	1512	1.10%	98.50%	0.26%	0.13%	NA
Aus	269	83.60%	6.30%	8.18%	1.86%	NA
Indica I	595	61.50%	0.50%	30.42%	7.56%	NA
Indica II	465	73.80%	3.00%	12.47%	10.75%	NA
Indica III	913	81.70%	0.70%	6.24%	11.39%	NA
Indica Intermediate	786	69.80%	2.20%	18.19%	9.80%	NA
Temperate Japonica	767	1.00%	98.70%	0.13%	0.13%	NA
Tropical Japonica	504	0.80%	98.60%	0.40%	0.20%	NA
Japonica Intermediate	241	1.70%	97.90%	0.41%	0.00%	NA
VI/Aromatic	96	5.20%	94.80%	0.00%	0.00%	NA
Intermediate	90	46.70%	44.40%	6.67%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0521659473	T -> DEL	N	N	silent_mutation	Average:58.374; most accessible tissue: Callus, score: 75.961	N	N	N	N
vg0521659473	T -> C	LOC_Os05g37060.1	upstream_gene_variant ; 4093.0bp to feature; MODIFIER	silent_mutation	Average:58.374; most accessible tissue: Callus, score: 75.961	N	N	N	N
vg0521659473	T -> C	LOC_Os05g37070.1	downstream_gene_variant ; 1876.0bp to feature; MODIFIER	silent_mutation	Average:58.374; most accessible tissue: Callus, score: 75.961	N	N	N	N
vg0521659473	T -> C	LOC_Os05g37060-LOC_Os05g37070	intergenic_region ; MODIFIER	silent_mutation	Average:58.374; most accessible tissue: Callus, score: 75.961	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0521659473	NA	1.27E-12	mr1149	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521659473	5.15E-06	NA	mr1265	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521659473	4.51E-06	NA	mr1050_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521659473	NA	1.30E-14	mr1162_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521659473	NA	7.73E-06	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521659473	9.15E-07	1.17E-07	mr1329_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521659473	6.61E-06	NA	mr1337_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521659473	NA	3.10E-19	mr1342_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521659473	9.79E-06	2.65E-07	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521659473	NA	1.95E-11	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521659473	NA	1.60E-08	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521659473	NA	1.73E-18	mr1637_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521659473	1.59E-06	NA	mr1652_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521659473	NA	1.01E-36	mr1689_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521659473	NA	2.27E-08	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521659473	NA	1.97E-13	mr1713_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521659473	NA	3.71E-06	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521659473	NA	6.21E-08	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521659473	NA	1.30E-07	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521659473	NA	5.84E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521659473	NA	6.70E-36	mr1888_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521659473	NA	1.02E-31	mr1891_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521659473	NA	2.35E-18	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521659473	3.86E-06	1.20E-07	mr1982_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251