| Variant ID: vg0521578860 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 21578860 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.55, A: 0.45, others allele: 0.00, population size: 101. )
AAAACAGAAAAGCAGCAGAAGTTGCGCTGCACAAAAATTCTACTTTGTTCTTCAGTTCTTGACGTTTCCCGAACTTCTTAAGGTTACTGTCGTTGTCCGG[C/A]
AATTTTCAGAGTGAGCGAGTGTGAGCGATTTCAGAGTTTGTTCTTTCCGTTTTGCTGACACCGCCGGGCGGCGGAGGGGCGCGACACCACCGGATTTGCC
GGCAAATCCGGTGGTGTCGCGCCCCTCCGCCGCCCGGCGGTGTCAGCAAAACGGAAAGAACAAACTCTGAAATCGCTCACACTCGCTCACTCTGAAAATT[G/T]
CCGGACAACGACAGTAACCTTAAGAAGTTCGGGAAACGTCAAGAACTGAAGAACAAAGTAGAATTTTTGTGCAGCGCAACTTCTGCTGCTTTTCTGTTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.50% | 37.60% | 5.23% | 0.70% | NA |
| All Indica | 2759 | 91.30% | 3.50% | 4.31% | 0.87% | NA |
| All Japonica | 1512 | 0.60% | 98.70% | 0.13% | 0.60% | NA |
| Aus | 269 | 33.50% | 20.40% | 46.10% | 0.00% | NA |
| Indica I | 595 | 98.30% | 0.70% | 0.84% | 0.17% | NA |
| Indica II | 465 | 85.60% | 4.50% | 7.74% | 2.15% | NA |
| Indica III | 913 | 91.80% | 3.20% | 4.27% | 0.77% | NA |
| Indica Intermediate | 786 | 88.90% | 5.30% | 4.96% | 0.76% | NA |
| Temperate Japonica | 767 | 0.70% | 98.80% | 0.00% | 0.52% | NA |
| Tropical Japonica | 504 | 0.60% | 98.20% | 0.40% | 0.79% | NA |
| Japonica Intermediate | 241 | 0.40% | 99.20% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 51.10% | 46.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0521578860 | C -> DEL | N | N | silent_mutation | Average:47.218; most accessible tissue: Zhenshan97 flower, score: 69.775 | N | N | N | N |
| vg0521578860 | C -> A | LOC_Os05g36940.1 | downstream_gene_variant ; 372.0bp to feature; MODIFIER | silent_mutation | Average:47.218; most accessible tissue: Zhenshan97 flower, score: 69.775 | N | N | N | N |
| vg0521578860 | C -> A | LOC_Os05g36950.1 | downstream_gene_variant ; 712.0bp to feature; MODIFIER | silent_mutation | Average:47.218; most accessible tissue: Zhenshan97 flower, score: 69.775 | N | N | N | N |
| vg0521578860 | C -> A | LOC_Os05g36940-LOC_Os05g36950 | intergenic_region ; MODIFIER | silent_mutation | Average:47.218; most accessible tissue: Zhenshan97 flower, score: 69.775 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0521578860 | 3.22E-11 | 1.28E-13 | mr1238 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521578860 | NA | 4.95E-27 | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521578860 | 8.11E-10 | 4.42E-12 | mr1309 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521578860 | NA | 1.44E-08 | mr1770 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521578860 | 1.02E-06 | 3.28E-08 | mr1841 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521578860 | 3.23E-07 | 3.23E-07 | mr1900 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521578860 | 2.46E-07 | 1.04E-08 | mr1238_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521578860 | NA | 2.90E-23 | mr1386_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521578860 | 2.54E-07 | 1.18E-08 | mr1484_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521578860 | 1.86E-08 | 7.59E-10 | mr1841_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521578860 | NA | 1.35E-06 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |