\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0521578860:

Variant ID: vg0521578860 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 21578860
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.55, A: 0.45, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


AAAACAGAAAAGCAGCAGAAGTTGCGCTGCACAAAAATTCTACTTTGTTCTTCAGTTCTTGACGTTTCCCGAACTTCTTAAGGTTACTGTCGTTGTCCGG[C/A]
AATTTTCAGAGTGAGCGAGTGTGAGCGATTTCAGAGTTTGTTCTTTCCGTTTTGCTGACACCGCCGGGCGGCGGAGGGGCGCGACACCACCGGATTTGCC

Reverse complement sequence

GGCAAATCCGGTGGTGTCGCGCCCCTCCGCCGCCCGGCGGTGTCAGCAAAACGGAAAGAACAAACTCTGAAATCGCTCACACTCGCTCACTCTGAAAATT[G/T]
CCGGACAACGACAGTAACCTTAAGAAGTTCGGGAAACGTCAAGAACTGAAGAACAAAGTAGAATTTTTGTGCAGCGCAACTTCTGCTGCTTTTCTGTTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.50% 37.60% 5.23% 0.70% NA
All Indica  2759 91.30% 3.50% 4.31% 0.87% NA
All Japonica  1512 0.60% 98.70% 0.13% 0.60% NA
Aus  269 33.50% 20.40% 46.10% 0.00% NA
Indica I  595 98.30% 0.70% 0.84% 0.17% NA
Indica II  465 85.60% 4.50% 7.74% 2.15% NA
Indica III  913 91.80% 3.20% 4.27% 0.77% NA
Indica Intermediate  786 88.90% 5.30% 4.96% 0.76% NA
Temperate Japonica  767 0.70% 98.80% 0.00% 0.52% NA
Tropical Japonica  504 0.60% 98.20% 0.40% 0.79% NA
Japonica Intermediate  241 0.40% 99.20% 0.00% 0.41% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 51.10% 46.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0521578860 C -> DEL N N silent_mutation Average:47.218; most accessible tissue: Zhenshan97 flower, score: 69.775 N N N N
vg0521578860 C -> A LOC_Os05g36940.1 downstream_gene_variant ; 372.0bp to feature; MODIFIER silent_mutation Average:47.218; most accessible tissue: Zhenshan97 flower, score: 69.775 N N N N
vg0521578860 C -> A LOC_Os05g36950.1 downstream_gene_variant ; 712.0bp to feature; MODIFIER silent_mutation Average:47.218; most accessible tissue: Zhenshan97 flower, score: 69.775 N N N N
vg0521578860 C -> A LOC_Os05g36940-LOC_Os05g36950 intergenic_region ; MODIFIER silent_mutation Average:47.218; most accessible tissue: Zhenshan97 flower, score: 69.775 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0521578860 3.22E-11 1.28E-13 mr1238 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521578860 NA 4.95E-27 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521578860 8.11E-10 4.42E-12 mr1309 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521578860 NA 1.44E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521578860 1.02E-06 3.28E-08 mr1841 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521578860 3.23E-07 3.23E-07 mr1900 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521578860 2.46E-07 1.04E-08 mr1238_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521578860 NA 2.90E-23 mr1386_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521578860 2.54E-07 1.18E-08 mr1484_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521578860 1.86E-08 7.59E-10 mr1841_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521578860 NA 1.35E-06 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251