Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0521578860:

Variant ID: vg0521578860 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 21578860
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.55, A: 0.45, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

AAAACAGAAAAGCAGCAGAAGTTGCGCTGCACAAAAATTCTACTTTGTTCTTCAGTTCTTGACGTTTCCCGAACTTCTTAAGGTTACTGTCGTTGTCCGG[C/A]
AATTTTCAGAGTGAGCGAGTGTGAGCGATTTCAGAGTTTGTTCTTTCCGTTTTGCTGACACCGCCGGGCGGCGGAGGGGCGCGACACCACCGGATTTGCC

Reverse complement sequence

GGCAAATCCGGTGGTGTCGCGCCCCTCCGCCGCCCGGCGGTGTCAGCAAAACGGAAAGAACAAACTCTGAAATCGCTCACACTCGCTCACTCTGAAAATT[G/T]
CCGGACAACGACAGTAACCTTAAGAAGTTCGGGAAACGTCAAGAACTGAAGAACAAAGTAGAATTTTTGTGCAGCGCAACTTCTGCTGCTTTTCTGTTTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.50%	37.60%	5.23%	0.70%	NA
All Indica	2759	91.30%	3.50%	4.31%	0.87%	NA
All Japonica	1512	0.60%	98.70%	0.13%	0.60%	NA
Aus	269	33.50%	20.40%	46.10%	0.00%	NA
Indica I	595	98.30%	0.70%	0.84%	0.17%	NA
Indica II	465	85.60%	4.50%	7.74%	2.15%	NA
Indica III	913	91.80%	3.20%	4.27%	0.77%	NA
Indica Intermediate	786	88.90%	5.30%	4.96%	0.76%	NA
Temperate Japonica	767	0.70%	98.80%	0.00%	0.52%	NA
Tropical Japonica	504	0.60%	98.20%	0.40%	0.79%	NA
Japonica Intermediate	241	0.40%	99.20%	0.00%	0.41%	NA
VI/Aromatic	96	3.10%	96.90%	0.00%	0.00%	NA
Intermediate	90	51.10%	46.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0521578860	C -> DEL	N	N	silent_mutation	Average:47.218; most accessible tissue: Zhenshan97 flower, score: 69.775	N	N	N	N
vg0521578860	C -> A	LOC_Os05g36940.1	downstream_gene_variant ; 372.0bp to feature; MODIFIER	silent_mutation	Average:47.218; most accessible tissue: Zhenshan97 flower, score: 69.775	N	N	N	N
vg0521578860	C -> A	LOC_Os05g36950.1	downstream_gene_variant ; 712.0bp to feature; MODIFIER	silent_mutation	Average:47.218; most accessible tissue: Zhenshan97 flower, score: 69.775	N	N	N	N
vg0521578860	C -> A	LOC_Os05g36940-LOC_Os05g36950	intergenic_region ; MODIFIER	silent_mutation	Average:47.218; most accessible tissue: Zhenshan97 flower, score: 69.775	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0521578860	3.22E-11	1.28E-13	mr1238	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521578860	NA	4.95E-27	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521578860	8.11E-10	4.42E-12	mr1309	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521578860	NA	1.44E-08	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521578860	1.02E-06	3.28E-08	mr1841	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521578860	3.23E-07	3.23E-07	mr1900	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521578860	2.46E-07	1.04E-08	mr1238_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521578860	NA	2.90E-23	mr1386_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521578860	2.54E-07	1.18E-08	mr1484_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521578860	1.86E-08	7.59E-10	mr1841_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521578860	NA	1.35E-06	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251