\
| Variant ID: vg0521569979 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 21569979 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGCGTGGTTCTACCTCCTCTCGCGCGACGATGCCGCCGGCGGCGGCAACCGCGACGACAGCTACAGACGTGCGTGGAGCCGGCTGTTGAGGAGGCTGGTG[C/T]
GGGAGAGCAGGAGCTTCTGTAGCCTCAGCATCAGCAGGCACGGTAATGTTAATTTTCGTGGATGACTTCACCAGAATCAAGAATCTGATTCTGAATTTGA
TCAAATTCAGAATCAGATTCTTGATTCTGGTGAAGTCATCCACGAAAATTAACATTACCGTGCCTGCTGATGCTGAGGCTACAGAAGCTCCTGCTCTCCC[G/A]
CACCAGCCTCCTCAACAGCCGGCTCCACGCACGTCTGTAGCTGTCGTCGCGGTTGCCGCCGCCGGCGGCATCGTCGCGCGAGAGGAGGTAGAACCACGCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.60% | 1.80% | 0.53% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.00% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 92.80% | 5.70% | 1.52% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 87.60% | 9.60% | 2.74% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.20% | 5.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0521569979 | C -> T | LOC_Os05g36920.1 | upstream_gene_variant ; 4377.0bp to feature; MODIFIER | silent_mutation | Average:64.461; most accessible tissue: Zhenshan97 panicle, score: 84.824 | N | N | N | N |
| vg0521569979 | C -> T | LOC_Os05g36940.1 | upstream_gene_variant ; 4202.0bp to feature; MODIFIER | silent_mutation | Average:64.461; most accessible tissue: Zhenshan97 panicle, score: 84.824 | N | N | N | N |
| vg0521569979 | C -> T | LOC_Os05g36930.1 | intron_variant ; MODIFIER | silent_mutation | Average:64.461; most accessible tissue: Zhenshan97 panicle, score: 84.824 | N | N | N | N |
| vg0521569979 | C -> T | LOC_Os05g36930.2 | intron_variant ; MODIFIER | silent_mutation | Average:64.461; most accessible tissue: Zhenshan97 panicle, score: 84.824 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0521569979 | 2.26E-08 | 2.26E-08 | mr1067 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521569979 | 6.22E-06 | NA | mr1078 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521569979 | 1.41E-06 | 1.23E-06 | mr1100 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521569979 | 6.09E-06 | 6.09E-06 | mr1402 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521569979 | 8.25E-06 | 4.65E-07 | mr1613 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521569979 | 6.82E-07 | 5.85E-09 | mr1619 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521569979 | 1.25E-06 | 1.25E-06 | mr1795 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521569979 | 3.17E-07 | 3.17E-07 | mr1855 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521569979 | NA | 2.63E-06 | mr1962 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |