Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0521569979:

Variant ID: vg0521569979 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 21569979
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGCGTGGTTCTACCTCCTCTCGCGCGACGATGCCGCCGGCGGCGGCAACCGCGACGACAGCTACAGACGTGCGTGGAGCCGGCTGTTGAGGAGGCTGGTG[C/T]
GGGAGAGCAGGAGCTTCTGTAGCCTCAGCATCAGCAGGCACGGTAATGTTAATTTTCGTGGATGACTTCACCAGAATCAAGAATCTGATTCTGAATTTGA

Reverse complement sequence

TCAAATTCAGAATCAGATTCTTGATTCTGGTGAAGTCATCCACGAAAATTAACATTACCGTGCCTGCTGATGCTGAGGCTACAGAAGCTCCTGCTCTCCC[G/A]
CACCAGCCTCCTCAACAGCCGGCTCCACGCACGTCTGTAGCTGTCGTCGCGGTTGCCGCCGCCGGCGGCATCGTCGCGCGAGAGGAGGTAGAACCACGCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.60%	1.80%	0.53%	0.00%	NA
All Indica	2759	99.90%	0.00%	0.07%	0.00%	NA
All Japonica	1512	92.80%	5.70%	1.52%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.00%	0.13%	0.00%	NA
Temperate Japonica	767	87.60%	9.60%	2.74%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	94.20%	5.00%	0.83%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0521569979	C -> T	LOC_Os05g36920.1	upstream_gene_variant ; 4377.0bp to feature; MODIFIER	silent_mutation	Average:64.461; most accessible tissue: Zhenshan97 panicle, score: 84.824	N	N	N	N
vg0521569979	C -> T	LOC_Os05g36940.1	upstream_gene_variant ; 4202.0bp to feature; MODIFIER	silent_mutation	Average:64.461; most accessible tissue: Zhenshan97 panicle, score: 84.824	N	N	N	N
vg0521569979	C -> T	LOC_Os05g36930.1	intron_variant ; MODIFIER	silent_mutation	Average:64.461; most accessible tissue: Zhenshan97 panicle, score: 84.824	N	N	N	N
vg0521569979	C -> T	LOC_Os05g36930.2	intron_variant ; MODIFIER	silent_mutation	Average:64.461; most accessible tissue: Zhenshan97 panicle, score: 84.824	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0521569979	2.26E-08	2.26E-08	mr1067	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521569979	6.22E-06	NA	mr1078	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521569979	1.41E-06	1.23E-06	mr1100	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521569979	6.09E-06	6.09E-06	mr1402	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521569979	8.25E-06	4.65E-07	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521569979	6.82E-07	5.85E-09	mr1619	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521569979	1.25E-06	1.25E-06	mr1795	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521569979	3.17E-07	3.17E-07	mr1855	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521569979	NA	2.63E-06	mr1962	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251