\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0521569979:

Variant ID: vg0521569979 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 21569979
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCGTGGTTCTACCTCCTCTCGCGCGACGATGCCGCCGGCGGCGGCAACCGCGACGACAGCTACAGACGTGCGTGGAGCCGGCTGTTGAGGAGGCTGGTG[C/T]
GGGAGAGCAGGAGCTTCTGTAGCCTCAGCATCAGCAGGCACGGTAATGTTAATTTTCGTGGATGACTTCACCAGAATCAAGAATCTGATTCTGAATTTGA

Reverse complement sequence

TCAAATTCAGAATCAGATTCTTGATTCTGGTGAAGTCATCCACGAAAATTAACATTACCGTGCCTGCTGATGCTGAGGCTACAGAAGCTCCTGCTCTCCC[G/A]
CACCAGCCTCCTCAACAGCCGGCTCCACGCACGTCTGTAGCTGTCGTCGCGGTTGCCGCCGCCGGCGGCATCGTCGCGCGAGAGGAGGTAGAACCACGCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.60% 1.80% 0.53% 0.00% NA
All Indica  2759 99.90% 0.00% 0.07% 0.00% NA
All Japonica  1512 92.80% 5.70% 1.52% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.00% 0.13% 0.00% NA
Temperate Japonica  767 87.60% 9.60% 2.74% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 94.20% 5.00% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0521569979 C -> T LOC_Os05g36920.1 upstream_gene_variant ; 4377.0bp to feature; MODIFIER silent_mutation Average:64.461; most accessible tissue: Zhenshan97 panicle, score: 84.824 N N N N
vg0521569979 C -> T LOC_Os05g36940.1 upstream_gene_variant ; 4202.0bp to feature; MODIFIER silent_mutation Average:64.461; most accessible tissue: Zhenshan97 panicle, score: 84.824 N N N N
vg0521569979 C -> T LOC_Os05g36930.1 intron_variant ; MODIFIER silent_mutation Average:64.461; most accessible tissue: Zhenshan97 panicle, score: 84.824 N N N N
vg0521569979 C -> T LOC_Os05g36930.2 intron_variant ; MODIFIER silent_mutation Average:64.461; most accessible tissue: Zhenshan97 panicle, score: 84.824 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0521569979 2.26E-08 2.26E-08 mr1067 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521569979 6.22E-06 NA mr1078 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521569979 1.41E-06 1.23E-06 mr1100 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521569979 6.09E-06 6.09E-06 mr1402 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521569979 8.25E-06 4.65E-07 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521569979 6.82E-07 5.85E-09 mr1619 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521569979 1.25E-06 1.25E-06 mr1795 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521569979 3.17E-07 3.17E-07 mr1855 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521569979 NA 2.63E-06 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251