\
| Variant ID: vg0521338739 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 21338739 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAAGCTCTTGGAGTCCTCTTTCCAATGGATCCATCCTCATTGTGAAATTCCATCTTATTGAGCCGCAATTGAAGCAACAAGTTGCCGCGTCACCTATAAT[G/A]
GGCCTATGGGCTTGTAACTTCGTATGGGACCCCGGCCCAAGTGGGGCCCATGTGGGGTGCGCCCCAACCAGGTGGAGCACGACCCTAGGGTTCCCTTAGG
CCTAAGGGAACCCTAGGGTCGTGCTCCACCTGGTTGGGGCGCACCCCACATGGGCCCCACTTGGGCCGGGGTCCCATACGAAGTTACAAGCCCATAGGCC[C/T]
ATTATAGGTGACGCGGCAACTTGTTGCTTCAATTGCGGCTCAATAAGATGGAATTTCACAATGAGGATGGATCCATTGGAAAGAGGACTCCAAGAGCTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.90% | 8.70% | 11.11% | 5.23% | NA |
| All Indica | 2759 | 74.30% | 0.40% | 16.49% | 8.81% | NA |
| All Japonica | 1512 | 72.90% | 25.30% | 1.72% | 0.07% | NA |
| Aus | 269 | 87.70% | 0.00% | 11.52% | 0.74% | NA |
| Indica I | 595 | 48.20% | 0.00% | 27.06% | 24.71% | NA |
| Indica II | 465 | 80.40% | 0.60% | 13.98% | 4.95% | NA |
| Indica III | 913 | 83.90% | 0.30% | 13.25% | 2.52% | NA |
| Indica Intermediate | 786 | 79.30% | 0.60% | 13.74% | 6.36% | NA |
| Temperate Japonica | 767 | 95.80% | 3.10% | 0.91% | 0.13% | NA |
| Tropical Japonica | 504 | 37.30% | 60.10% | 2.58% | 0.00% | NA |
| Japonica Intermediate | 241 | 74.30% | 23.20% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 7.30% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 12.20% | 13.33% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0521338739 | G -> DEL | LOC_Os05g36040.1 | N | frameshift_variant | Average:31.494; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0521338739 | G -> A | LOC_Os05g36040.1 | missense_variant ; p.Met555Ile; MODERATE | nonsynonymous_codon ; M555I | Average:31.494; most accessible tissue: Minghui63 panicle, score: 64.459 | benign |
0.822 |
TOLERATED | 0.19 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0521338739 | NA | 8.10E-10 | mr1093_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521338739 | NA | 2.28E-07 | mr1121_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521338739 | NA | 1.72E-10 | mr1235_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521338739 | NA | 1.87E-08 | mr1243_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521338739 | NA | 1.05E-07 | mr1248_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521338739 | NA | 1.72E-06 | mr1250_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521338739 | NA | 8.76E-09 | mr1423_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521338739 | NA | 6.71E-08 | mr1599_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521338739 | 2.52E-07 | 2.52E-07 | mr1603_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |