\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0521338739:

Variant ID: vg0521338739 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 21338739
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAGCTCTTGGAGTCCTCTTTCCAATGGATCCATCCTCATTGTGAAATTCCATCTTATTGAGCCGCAATTGAAGCAACAAGTTGCCGCGTCACCTATAAT[G/A]
GGCCTATGGGCTTGTAACTTCGTATGGGACCCCGGCCCAAGTGGGGCCCATGTGGGGTGCGCCCCAACCAGGTGGAGCACGACCCTAGGGTTCCCTTAGG

Reverse complement sequence

CCTAAGGGAACCCTAGGGTCGTGCTCCACCTGGTTGGGGCGCACCCCACATGGGCCCCACTTGGGCCGGGGTCCCATACGAAGTTACAAGCCCATAGGCC[C/T]
ATTATAGGTGACGCGGCAACTTGTTGCTTCAATTGCGGCTCAATAAGATGGAATTTCACAATGAGGATGGATCCATTGGAAAGAGGACTCCAAGAGCTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.90% 8.70% 11.11% 5.23% NA
All Indica  2759 74.30% 0.40% 16.49% 8.81% NA
All Japonica  1512 72.90% 25.30% 1.72% 0.07% NA
Aus  269 87.70% 0.00% 11.52% 0.74% NA
Indica I  595 48.20% 0.00% 27.06% 24.71% NA
Indica II  465 80.40% 0.60% 13.98% 4.95% NA
Indica III  913 83.90% 0.30% 13.25% 2.52% NA
Indica Intermediate  786 79.30% 0.60% 13.74% 6.36% NA
Temperate Japonica  767 95.80% 3.10% 0.91% 0.13% NA
Tropical Japonica  504 37.30% 60.10% 2.58% 0.00% NA
Japonica Intermediate  241 74.30% 23.20% 2.49% 0.00% NA
VI/Aromatic  96 91.70% 7.30% 1.04% 0.00% NA
Intermediate  90 73.30% 12.20% 13.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0521338739 G -> DEL LOC_Os05g36040.1 N frameshift_variant Average:31.494; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0521338739 G -> A LOC_Os05g36040.1 missense_variant ; p.Met555Ile; MODERATE nonsynonymous_codon ; M555I Average:31.494; most accessible tissue: Minghui63 panicle, score: 64.459 benign 0.822 TOLERATED 0.19

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0521338739 NA 8.10E-10 mr1093_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338739 NA 2.28E-07 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338739 NA 1.72E-10 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338739 NA 1.87E-08 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338739 NA 1.05E-07 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338739 NA 1.72E-06 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338739 NA 8.76E-09 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338739 NA 6.71E-08 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521338739 2.52E-07 2.52E-07 mr1603_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251