\
| Variant ID: vg0521119103 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 21119103 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 250. )
TTTGAGGGCATGTTTGGAAAAGTTTTTAGCTGCTACACTTTCTCTTAGAGTCTAGGTTTTAAAAACAAGTAGGTGTAGAATCCAGAAAATAAACTAGAAA[T/C]
CAGAAGCTTGGAAAACCAGCTAACAGGTCCTGGGAATATGCACTCTATTTTAGCCGCACATGTTTAACCGTGGGACATTTAATTTTTTTTTAACTTTTAA
TTAAAAGTTAAAAAAAAATTAAATGTCCCACGGTTAAACATGTGCGGCTAAAATAGAGTGCATATTCCCAGGACCTGTTAGCTGGTTTTCCAAGCTTCTG[A/G]
TTTCTAGTTTATTTTCTGGATTCTACACCTACTTGTTTTTAAAACCTAGACTCTAAGAGAAAGTGTAGCAGCTAAAAACTTTTCCAAACATGCCCTCAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.60% | 3.50% | 0.93% | 0.00% | NA |
| All Indica | 2759 | 92.60% | 5.80% | 1.52% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.90% | 0.40% | 0.74% | 0.00% | NA |
| Indica I | 595 | 87.70% | 8.70% | 3.53% | 0.00% | NA |
| Indica II | 465 | 84.30% | 12.90% | 2.80% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.90% | 6.10% | 1.02% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0521119103 | T -> C | LOC_Os05g35530.1 | upstream_gene_variant ; 1714.0bp to feature; MODIFIER | silent_mutation | Average:70.718; most accessible tissue: Minghui63 root, score: 88.953 | N | N | N | N |
| vg0521119103 | T -> C | LOC_Os05g35520.1 | downstream_gene_variant ; 1705.0bp to feature; MODIFIER | silent_mutation | Average:70.718; most accessible tissue: Minghui63 root, score: 88.953 | N | N | N | N |
| vg0521119103 | T -> C | LOC_Os05g35520.2 | downstream_gene_variant ; 1705.0bp to feature; MODIFIER | silent_mutation | Average:70.718; most accessible tissue: Minghui63 root, score: 88.953 | N | N | N | N |
| vg0521119103 | T -> C | LOC_Os05g35520.3 | downstream_gene_variant ; 1705.0bp to feature; MODIFIER | silent_mutation | Average:70.718; most accessible tissue: Minghui63 root, score: 88.953 | N | N | N | N |
| vg0521119103 | T -> C | LOC_Os05g35520-LOC_Os05g35530 | intergenic_region ; MODIFIER | silent_mutation | Average:70.718; most accessible tissue: Minghui63 root, score: 88.953 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0521119103 | 8.59E-06 | 1.62E-09 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521119103 | NA | 1.40E-09 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521119103 | 9.34E-08 | 1.20E-12 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521119103 | 2.72E-06 | 2.11E-12 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521119103 | 2.32E-09 | 2.17E-14 | mr1038_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521119103 | 5.15E-08 | 3.78E-14 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521119103 | 2.91E-06 | NA | mr1141_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521119103 | 8.39E-06 | NA | mr1141_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521119103 | 4.19E-08 | 1.41E-12 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0521119103 | 6.90E-07 | 8.73E-13 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |