\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0521119103:

Variant ID: vg0521119103 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 21119103
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGAGGGCATGTTTGGAAAAGTTTTTAGCTGCTACACTTTCTCTTAGAGTCTAGGTTTTAAAAACAAGTAGGTGTAGAATCCAGAAAATAAACTAGAAA[T/C]
CAGAAGCTTGGAAAACCAGCTAACAGGTCCTGGGAATATGCACTCTATTTTAGCCGCACATGTTTAACCGTGGGACATTTAATTTTTTTTTAACTTTTAA

Reverse complement sequence

TTAAAAGTTAAAAAAAAATTAAATGTCCCACGGTTAAACATGTGCGGCTAAAATAGAGTGCATATTCCCAGGACCTGTTAGCTGGTTTTCCAAGCTTCTG[A/G]
TTTCTAGTTTATTTTCTGGATTCTACACCTACTTGTTTTTAAAACCTAGACTCTAAGAGAAAGTGTAGCAGCTAAAAACTTTTCCAAACATGCCCTCAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.60% 3.50% 0.93% 0.00% NA
All Indica  2759 92.60% 5.80% 1.52% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 98.90% 0.40% 0.74% 0.00% NA
Indica I  595 87.70% 8.70% 3.53% 0.00% NA
Indica II  465 84.30% 12.90% 2.80% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 92.90% 6.10% 1.02% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0521119103 T -> C LOC_Os05g35530.1 upstream_gene_variant ; 1714.0bp to feature; MODIFIER silent_mutation Average:70.718; most accessible tissue: Minghui63 root, score: 88.953 N N N N
vg0521119103 T -> C LOC_Os05g35520.1 downstream_gene_variant ; 1705.0bp to feature; MODIFIER silent_mutation Average:70.718; most accessible tissue: Minghui63 root, score: 88.953 N N N N
vg0521119103 T -> C LOC_Os05g35520.2 downstream_gene_variant ; 1705.0bp to feature; MODIFIER silent_mutation Average:70.718; most accessible tissue: Minghui63 root, score: 88.953 N N N N
vg0521119103 T -> C LOC_Os05g35520.3 downstream_gene_variant ; 1705.0bp to feature; MODIFIER silent_mutation Average:70.718; most accessible tissue: Minghui63 root, score: 88.953 N N N N
vg0521119103 T -> C LOC_Os05g35520-LOC_Os05g35530 intergenic_region ; MODIFIER silent_mutation Average:70.718; most accessible tissue: Minghui63 root, score: 88.953 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0521119103 8.59E-06 1.62E-09 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521119103 NA 1.40E-09 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521119103 9.34E-08 1.20E-12 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521119103 2.72E-06 2.11E-12 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521119103 2.32E-09 2.17E-14 mr1038_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521119103 5.15E-08 3.78E-14 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521119103 2.91E-06 NA mr1141_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521119103 8.39E-06 NA mr1141_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521119103 4.19E-08 1.41E-12 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521119103 6.90E-07 8.73E-13 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251