\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0521003207:

Variant ID: vg0521003207 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 21003207
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGATTTAGGCCCGGTTTAAATCCCATGGTAAATTTTTTCACCCTATCACATCGAATATTATACACATGTATGAAGTATTAAATATATAAAAAATAAAAA[C/A]
TTGTTACACAGATTGCGTGTAAATTGCAGGACGAATCTTTTAAGCCTAATTGTTTCATGATTTAACAATGTAGTGTTGTAGTAAATATTGGTAATGACGG

Reverse complement sequence

CCGTCATTACCAATATTTACTACAACACTACATTGTTAAATCATGAAACAATTAGGCTTAAAAGATTCGTCCTGCAATTTACACGCAATCTGTGTAACAA[G/T]
TTTTTATTTTTTATATATTTAATACTTCATACATGTGTATAATATTCGATGTGATAGGGTGAAAAAATTTACCATGGGATTTAAACCGGGCCTAAATCAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.10% 13.20% 26.83% 23.78% NA
All Indica  2759 2.20% 19.90% 40.05% 37.88% NA
All Japonica  1512 97.90% 0.50% 0.60% 0.99% NA
Aus  269 13.40% 23.40% 46.84% 16.36% NA
Indica I  595 1.00% 17.60% 46.39% 34.96% NA
Indica II  465 1.70% 23.90% 36.13% 38.28% NA
Indica III  913 1.50% 18.60% 37.46% 42.39% NA
Indica Intermediate  786 4.10% 20.70% 40.59% 34.61% NA
Temperate Japonica  767 96.60% 0.80% 1.04% 1.56% NA
Tropical Japonica  504 99.40% 0.00% 0.20% 0.40% NA
Japonica Intermediate  241 99.20% 0.40% 0.00% 0.41% NA
VI/Aromatic  96 96.90% 0.00% 3.12% 0.00% NA
Intermediate  90 42.20% 7.80% 27.78% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0521003207 C -> DEL N N silent_mutation Average:41.694; most accessible tissue: Callus, score: 71.538 N N N N
vg0521003207 C -> A LOC_Os05g35360.1 upstream_gene_variant ; 4895.0bp to feature; MODIFIER silent_mutation Average:41.694; most accessible tissue: Callus, score: 71.538 N N N N
vg0521003207 C -> A LOC_Os05g35370.1 upstream_gene_variant ; 1912.0bp to feature; MODIFIER silent_mutation Average:41.694; most accessible tissue: Callus, score: 71.538 N N N N
vg0521003207 C -> A LOC_Os05g35380.1 downstream_gene_variant ; 3476.0bp to feature; MODIFIER silent_mutation Average:41.694; most accessible tissue: Callus, score: 71.538 N N N N
vg0521003207 C -> A LOC_Os05g35370-LOC_Os05g35380 intergenic_region ; MODIFIER silent_mutation Average:41.694; most accessible tissue: Callus, score: 71.538 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0521003207 NA 2.41E-76 mr1027 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521003207 NA 3.16E-87 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521003207 NA 1.50E-68 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521003207 NA 2.09E-36 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521003207 NA 8.03E-61 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521003207 NA 6.85E-80 mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521003207 NA 6.13E-93 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521003207 NA 1.41E-53 mr1889 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521003207 NA 4.43E-41 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521003207 NA 1.54E-52 mr1136_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521003207 NA 3.70E-36 mr1181_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521003207 NA 2.58E-28 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521003207 NA 2.43E-40 mr1243_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521003207 NA 3.67E-16 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521003207 NA 8.15E-26 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521003207 NA 4.50E-96 mr1536_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521003207 NA 2.61E-37 mr1541_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521003207 NA 1.13E-43 mr1542_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521003207 NA 9.94E-46 mr1591_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521003207 NA 1.78E-67 mr1594_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521003207 NA 2.58E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521003207 NA 1.18E-37 mr1689_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521003207 NA 1.82E-12 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521003207 NA 3.46E-106 mr1718_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521003207 NA 9.73E-62 mr1733_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521003207 NA 5.19E-86 mr1795_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521003207 NA 6.07E-32 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521003207 NA 1.27E-38 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0521003207 NA 2.84E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251