\
| Variant ID: vg0520975375 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 20975375 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 103. )
GCATGTCATCCTTTATGTGAATGATAAATGGACCATACATATATTTTTTTAATTCTAATGCCACGTAACCGCCACGTCAACGCCACGTGTAAGAAAGACC[T/C]
GGTTAGCACCGTCACGTAGGTGCCACGTCAGCAAAACCGCCCTCTAAAACCGCCGAGGGAGTCAAATTGTACTGGTTTTAAGAGTTGGTGGTCTAGATAT
ATATCTAGACCACCAACTCTTAAAACCAGTACAATTTGACTCCCTCGGCGGTTTTAGAGGGCGGTTTTGCTGACGTGGCACCTACGTGACGGTGCTAACC[A/G]
GGTCTTTCTTACACGTGGCGTTGACGTGGCGGTTACGTGGCATTAGAATTAAAAAAATATATGTATGGTCCATTTATCATTCACATAAAGGATGACATGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 25.90% | 10.40% | 2.45% | 61.28% | NA |
| All Indica | 2759 | 3.70% | 0.40% | 0.51% | 95.36% | NA |
| All Japonica | 1512 | 60.10% | 31.20% | 6.61% | 2.12% | NA |
| Aus | 269 | 32.30% | 0.00% | 0.00% | 67.66% | NA |
| Indica I | 595 | 0.50% | 0.30% | 0.50% | 98.66% | NA |
| Indica II | 465 | 2.60% | 0.60% | 0.65% | 96.13% | NA |
| Indica III | 913 | 6.80% | 0.10% | 0.00% | 93.10% | NA |
| Indica Intermediate | 786 | 3.20% | 0.80% | 1.02% | 95.04% | NA |
| Temperate Japonica | 767 | 33.80% | 52.50% | 10.17% | 3.52% | NA |
| Tropical Japonica | 504 | 95.80% | 1.20% | 2.38% | 0.60% | NA |
| Japonica Intermediate | 241 | 69.30% | 25.70% | 4.15% | 0.83% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 1.04% | 3.12% | NA |
| Intermediate | 90 | 36.70% | 8.90% | 1.11% | 53.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0520975375 | T -> DEL | N | N | silent_mutation | Average:59.41; most accessible tissue: Callus, score: 78.593 | N | N | N | N |
| vg0520975375 | T -> C | LOC_Os05g35320.1 | upstream_gene_variant ; 2503.0bp to feature; MODIFIER | silent_mutation | Average:59.41; most accessible tissue: Callus, score: 78.593 | N | N | N | N |
| vg0520975375 | T -> C | LOC_Os05g35330.1 | downstream_gene_variant ; 1045.0bp to feature; MODIFIER | silent_mutation | Average:59.41; most accessible tissue: Callus, score: 78.593 | N | N | N | N |
| vg0520975375 | T -> C | LOC_Os05g35340.1 | downstream_gene_variant ; 3159.0bp to feature; MODIFIER | silent_mutation | Average:59.41; most accessible tissue: Callus, score: 78.593 | N | N | N | N |
| vg0520975375 | T -> C | LOC_Os05g35330-LOC_Os05g35340 | intergenic_region ; MODIFIER | silent_mutation | Average:59.41; most accessible tissue: Callus, score: 78.593 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0520975375 | NA | 4.11E-12 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0520975375 | NA | 3.72E-17 | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0520975375 | NA | 5.05E-11 | Spikelet_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0520975375 | NA | 6.10E-07 | mr1077 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520975375 | NA | 5.31E-08 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520975375 | NA | 2.05E-06 | mr1202 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520975375 | NA | 1.18E-06 | mr1205 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520975375 | NA | 4.63E-07 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520975375 | NA | 1.10E-06 | mr1252 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520975375 | NA | 1.16E-07 | mr1271 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520975375 | NA | 4.65E-09 | mr1271 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520975375 | NA | 5.28E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520975375 | NA | 2.73E-06 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520975375 | NA | 8.79E-06 | mr1550 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520975375 | NA | 7.84E-06 | mr1596 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520975375 | NA | 5.13E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520975375 | NA | 8.35E-08 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520975375 | NA | 6.34E-07 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520975375 | NA | 6.67E-06 | mr1775 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520975375 | NA | 6.98E-06 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520975375 | NA | 1.16E-08 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520975375 | NA | 1.90E-06 | mr1588_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520975375 | NA | 1.18E-11 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520975375 | NA | 1.96E-07 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520975375 | NA | 3.32E-09 | mr1805_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520975375 | 2.34E-06 | 2.33E-06 | mr1919_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |