\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0520914961:

Variant ID: vg0520914961 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 20914961
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACGTTGGATATACGGGCACACATTTGAAGTATTAAATGTAGGCTAATAACAAAATAAATTACAGATTCTGCCTGTAAACCACGAGACGAATTTTTTAAG[C/A]
CTAATTAATCCGTCATTAGTAAATGTTTACTGTAGCACCACATTGTCAAATCATGGAGCAATAATTAGTCTTAAAAGATTTATCTCGCAATTTACACGCA

Reverse complement sequence

TGCGTGTAAATTGCGAGATAAATCTTTTAAGACTAATTATTGCTCCATGATTTGACAATGTGGTGCTACAGTAAACATTTACTAATGACGGATTAATTAG[G/T]
CTTAAAAAATTCGTCTCGTGGTTTACAGGCAGAATCTGTAATTTATTTTGTTATTAGCCTACATTTAATACTTCAAATGTGTGCCCGTATATCCAACGTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.60% 37.20% 4.13% 5.10% NA
All Indica  2759 81.80% 3.30% 6.74% 8.12% NA
All Japonica  1512 1.80% 97.90% 0.07% 0.20% NA
Aus  269 76.60% 19.00% 1.12% 3.35% NA
Indica I  595 80.70% 0.80% 13.28% 5.21% NA
Indica II  465 81.10% 3.00% 6.45% 9.46% NA
Indica III  913 82.30% 5.60% 2.41% 9.75% NA
Indica Intermediate  786 82.60% 2.80% 7.00% 7.63% NA
Temperate Japonica  767 2.90% 96.60% 0.13% 0.39% NA
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 95.80% 1.04% 0.00% NA
Intermediate  90 45.60% 44.40% 4.44% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0520914961 C -> DEL N N silent_mutation Average:39.255; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0520914961 C -> A LOC_Os05g35210.1 upstream_gene_variant ; 636.0bp to feature; MODIFIER silent_mutation Average:39.255; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0520914961 C -> A LOC_Os05g35210-LOC_Os05g35220 intergenic_region ; MODIFIER silent_mutation Average:39.255; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0520914961 NA 1.02E-66 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520914961 NA 6.32E-36 mr1181_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520914961 NA 2.23E-38 mr1264_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520914961 NA 8.21E-16 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520914961 NA 1.03E-23 mr1708_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520914961 NA 1.27E-07 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520914961 NA 5.17E-08 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520914961 NA 1.42E-40 mr1888_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251