\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0520889189:

Variant ID: vg0520889189 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 20889189
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGAAGCCGACGCCGTTGCTGTCGACATTGGCGGTCTGACCGAGCCAGCTGGCCGGTCTAACCGCCAGACTACGGCCGGTCTGACCGGTCCTTCTAGCCG[A/G]
TCTGACCGACGGCTTGTGGCCGGTCTGACCGGGCCCAGAGGCCGGTCTGACCGGGGGGCATTGAAGAAGAGTGGGAAAATTGAGAGCAACATAGGAGCTT

Reverse complement sequence

AAGCTCCTATGTTGCTCTCAATTTTCCCACTCTTCTTCAATGCCCCCCGGTCAGACCGGCCTCTGGGCCCGGTCAGACCGGCCACAAGCCGTCGGTCAGA[T/C]
CGGCTAGAAGGACCGGTCAGACCGGCCGTAGTCTGGCGGTTAGACCGGCCAGCTGGCTCGGTCAGACCGCCAATGTCGACAGCAACGGCGTCGGCTTCAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.40% 34.20% 0.04% 0.34% NA
All Indica  2759 99.00% 0.70% 0.00% 0.36% NA
All Japonica  1512 2.10% 97.60% 0.00% 0.40% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.20% 0.50% 0.00% 0.34% NA
Indica II  465 98.10% 1.70% 0.00% 0.22% NA
Indica III  913 99.50% 0.20% 0.00% 0.33% NA
Indica Intermediate  786 98.90% 0.60% 0.00% 0.51% NA
Temperate Japonica  767 3.40% 96.60% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 98.80% 0.00% 0.60% NA
Japonica Intermediate  241 0.80% 97.90% 0.00% 1.24% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 63.30% 34.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0520889189 A -> DEL LOC_Os05g35180.1 N frameshift_variant Average:52.284; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N
vg0520889189 A -> G LOC_Os05g35180.1 synonymous_variant ; p.Arg821Arg; LOW synonymous_codon Average:52.284; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0520889189 NA 2.47E-68 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520889189 NA 1.31E-74 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520889189 NA 2.76E-78 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520889189 NA 5.00E-91 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520889189 NA 1.16E-42 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520889189 NA 3.51E-60 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520889189 NA 2.70E-88 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520889189 NA 3.22E-89 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520889189 2.98E-06 2.98E-06 mr1770 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520889189 NA 2.53E-20 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520889189 NA 8.01E-40 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520889189 NA 1.18E-39 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520889189 NA 9.19E-102 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520889189 NA 1.59E-35 mr1181_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520889189 NA 2.67E-18 mr1281_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520889189 NA 5.10E-17 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520889189 NA 2.94E-38 mr1541_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520889189 NA 1.13E-45 mr1591_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520889189 NA 8.49E-70 mr1594_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520889189 NA 5.61E-23 mr1708_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520889189 NA 1.41E-86 mr1795_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520889189 NA 2.82E-36 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251