\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0520855996:

Variant ID: vg0520855996 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 20855996
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAAATTATGGTTGTTTTAATATCCAACATTATTTTGAATTGAACATAGCTTAATTGGTTATGTTCCTTTGGTGGAAATTACCCACTCGTGTAATTTTTT[T/C]
AGTGGTCCACCGAATTAAATGAAAATCGAAGGTGGGATGTTTTTCTTTTTTCTCAAAATTTGTAAGGTTTTCTCTAATTTATTAGAGTGCCACACGGTAA

Reverse complement sequence

TTACCGTGTGGCACTCTAATAAATTAGAGAAAACCTTACAAATTTTGAGAAAAAAGAAAAACATCCCACCTTCGATTTTCATTTAATTCGGTGGACCACT[A/G]
AAAAAATTACACGAGTGGGTAATTTCCACCAAAGGAACATAACCAATTAAGCTATGTTCAATTCAAAATAATGTTGGATATTAAAACAACCATAATTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.30% 34.30% 0.11% 0.32% NA
All Indica  2759 98.90% 0.70% 0.14% 0.25% NA
All Japonica  1512 2.10% 97.60% 0.00% 0.40% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.50% 0.70% 0.50% 0.34% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 99.50% 0.20% 0.11% 0.22% NA
Indica Intermediate  786 99.00% 0.60% 0.00% 0.38% NA
Temperate Japonica  767 3.40% 96.60% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 98.80% 0.00% 0.60% NA
Japonica Intermediate  241 0.80% 97.90% 0.00% 1.24% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 58.90% 37.80% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0520855996 T -> DEL N N silent_mutation Average:38.106; most accessible tissue: Callus, score: 56.743 N N N N
vg0520855996 T -> C LOC_Os05g35110.1 downstream_gene_variant ; 4899.0bp to feature; MODIFIER silent_mutation Average:38.106; most accessible tissue: Callus, score: 56.743 N N N N
vg0520855996 T -> C LOC_Os05g35110-LOC_Os05g35130 intergenic_region ; MODIFIER silent_mutation Average:38.106; most accessible tissue: Callus, score: 56.743 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0520855996 NA 6.30E-75 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520855996 NA 6.83E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520855996 NA 6.44E-86 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520855996 NA 1.82E-39 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520855996 NA 8.66E-57 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520855996 NA 5.48E-34 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520855996 NA 1.14E-10 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520855996 NA 9.08E-89 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520855996 NA 1.05E-17 mr1767 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520855996 NA 1.29E-21 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520855996 NA 1.52E-22 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520855996 NA 9.85E-40 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520855996 NA 1.23E-101 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520855996 NA 5.67E-11 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520855996 NA 9.58E-76 mr1246_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520855996 NA 8.18E-18 mr1281_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520855996 NA 8.33E-16 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520855996 NA 6.79E-48 mr1542_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520855996 NA 2.36E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520855996 NA 7.43E-62 mr1733_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520855996 NA 9.45E-86 mr1795_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520855996 NA 3.01E-39 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251