Variant ID: vg0520829830 (JBrowse) | Variation Type: SNP |
Chromosome: chr05 | Position: 20829830 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GACAAGTCACGCATAAAATATTAATCATGTTTTATCATCTAACAACAATAAAAATATGAATTATAAAAAAATTTCATATAAGACGGACAGTCAAAGTTGG[G/A]
CATGGAAACCCAGAGTTTGCCTTTTTTTGGGACGGAGGGAGTACATATATGTTTTTTTTTTTGAAAATGTAGTTAAAACTACCTGCTTCCTCTTTTTTAG
CTAAAAAAGAGGAAGCAGGTAGTTTTAACTACATTTTCAAAAAAAAAAACATATATGTACTCCCTCCGTCCCAAAAAAAGGCAAACTCTGGGTTTCCATG[C/T]
CCAACTTTGACTGTCCGTCTTATATGAAATTTTTTTATAATTCATATTTTTATTGTTGTTAGATGATAAAACATGATTAATATTTTATGCGTGACTTGTC
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 65.40% | 34.50% | 0.11% | 0.00% | NA |
All Indica | 2759 | 98.90% | 0.90% | 0.18% | 0.00% | NA |
All Japonica | 1512 | 2.20% | 97.80% | 0.00% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.00% | 0.70% | 0.34% | 0.00% | NA |
Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.50% | 0.40% | 0.11% | 0.00% | NA |
Indica Intermediate | 786 | 98.90% | 0.90% | 0.25% | 0.00% | NA |
Temperate Japonica | 767 | 3.40% | 96.60% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 0.60% | 99.40% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
Intermediate | 90 | 60.00% | 40.00% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0520829830 | G -> A | LOC_Os05g35080.1 | downstream_gene_variant ; 545.0bp to feature; MODIFIER | silent_mutation | Average:38.504; most accessible tissue: Zhenshan97 flower, score: 73.683 | N | N | N | N |
vg0520829830 | G -> A | LOC_Os05g35080-LOC_Os05g35090 | intergenic_region ; MODIFIER | silent_mutation | Average:38.504; most accessible tissue: Zhenshan97 flower, score: 73.683 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0520829830 | NA | 3.62E-104 | mr1008 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0520829830 | NA | 1.51E-102 | mr1009 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0520829830 | NA | 6.14E-75 | mr1014 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0520829830 | NA | 1.18E-74 | mr1027 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0520829830 | NA | 6.23E-76 | mr1135 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0520829830 | NA | 1.15E-10 | mr1281 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0520829830 | 3.00E-06 | NA | mr1328 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0520829830 | NA | 2.97E-86 | mr1504 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0520829830 | NA | 5.16E-86 | mr1517 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0520829830 | NA | 3.29E-35 | mr1542 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/