RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0520829830:

Variant ID: vg0520829830 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 20829830
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GACAAGTCACGCATAAAATATTAATCATGTTTTATCATCTAACAACAATAAAAATATGAATTATAAAAAAATTTCATATAAGACGGACAGTCAAAGTTGG[G/A]
CATGGAAACCCAGAGTTTGCCTTTTTTTGGGACGGAGGGAGTACATATATGTTTTTTTTTTTGAAAATGTAGTTAAAACTACCTGCTTCCTCTTTTTTAG

Reverse complement sequence

CTAAAAAAGAGGAAGCAGGTAGTTTTAACTACATTTTCAAAAAAAAAAACATATATGTACTCCCTCCGTCCCAAAAAAAGGCAAACTCTGGGTTTCCATG[C/T]
CCAACTTTGACTGTCCGTCTTATATGAAATTTTTTTATAATTCATATTTTTATTGTTGTTAGATGATAAAACATGATTAATATTTTATGCGTGACTTGTC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.40%	34.50%	0.11%	0.00%	NA
All Indica	2759	98.90%	0.90%	0.18%	0.00%	NA
All Japonica	1512	2.20%	97.80%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.00%	0.70%	0.34%	0.00%	NA
Indica II	465	98.10%	1.90%	0.00%	0.00%	NA
Indica III	913	99.50%	0.40%	0.11%	0.00%	NA
Indica Intermediate	786	98.90%	0.90%	0.25%	0.00%	NA
Temperate Japonica	767	3.40%	96.60%	0.00%	0.00%	NA
Tropical Japonica	504	0.60%	99.40%	0.00%	0.00%	NA
Japonica Intermediate	241	1.70%	98.30%	0.00%	0.00%	NA
VI/Aromatic	96	4.20%	95.80%	0.00%	0.00%	NA
Intermediate	90	60.00%	40.00%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0520829830	G -> A	LOC_Os05g35080.1	downstream_gene_variant ; 545.0bp to feature; MODIFIER	silent_mutation	Average:38.504; most accessible tissue: Zhenshan97 flower, score: 73.683	N	N	N	N
vg0520829830	G -> A	LOC_Os05g35080-LOC_Os05g35090	intergenic_region ; MODIFIER	silent_mutation	Average:38.504; most accessible tissue: Zhenshan97 flower, score: 73.683	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0520829830	NA	3.62E-104	mr1008	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520829830	NA	1.51E-102	mr1009	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520829830	NA	6.14E-75	mr1014	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520829830	NA	1.18E-74	mr1027	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520829830	NA	6.23E-76	mr1135	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520829830	NA	1.15E-10	mr1281	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520829830	3.00E-06	NA	mr1328	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520829830	NA	2.97E-86	mr1504	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520829830	NA	5.16E-86	mr1517	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520829830	NA	3.29E-35	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 18 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0520829830:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact