\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0520821970:

Variant ID: vg0520821970 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 20821970
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGAGGCACCTCTAATTTAAATGATAACATCTAATTTTTAATAATTAAAAGGTAACAAGTACTCCTCCCATTGTCCCGATTTGTTGTCTTATATATAGAGT[T/C]
ATAGGGCCGGTTCACTTTGATGCCAAAAAAAACTTACCAAATTGGCATTGCCAAAATTTTGGCATAGTTACCAAAATTTTGGTAACTTGCCAAAATTTTA

Reverse complement sequence

TAAAATTTTGGCAAGTTACCAAAATTTTGGTAACTATGCCAAAATTTTGGCAATGCCAATTTGGTAAGTTTTTTTTGGCATCAAAGTGAACCGGCCCTAT[A/G]
ACTCTATATATAAGACAACAAATCGGGACAATGGGAGGAGTACTTGTTACCTTTTAATTATTAAAAATTAGATGTTATCATTTAAATTAGAGGTGCCTCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.10% 19.40% 1.40% 0.04% NA
All Indica  2759 99.30% 0.40% 0.18% 0.04% NA
All Japonica  1512 44.00% 52.50% 3.51% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.30% 1.50% 0.22% 0.00% NA
Indica III  913 99.70% 0.10% 0.11% 0.11% NA
Indica Intermediate  786 99.10% 0.50% 0.38% 0.00% NA
Temperate Japonica  767 74.20% 21.10% 4.69% 0.00% NA
Tropical Japonica  504 2.00% 96.60% 1.39% 0.00% NA
Japonica Intermediate  241 35.70% 60.20% 4.15% 0.00% NA
VI/Aromatic  96 6.20% 91.70% 1.04% 1.04% NA
Intermediate  90 65.60% 26.70% 7.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0520821970 T -> DEL N N silent_mutation Average:51.76; most accessible tissue: Callus, score: 82.287 N N N N
vg0520821970 T -> C LOC_Os05g35070.1 upstream_gene_variant ; 1190.0bp to feature; MODIFIER silent_mutation Average:51.76; most accessible tissue: Callus, score: 82.287 N N N N
vg0520821970 T -> C LOC_Os05g35070-LOC_Os05g35080 intergenic_region ; MODIFIER silent_mutation Average:51.76; most accessible tissue: Callus, score: 82.287 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0520821970 NA 8.67E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970 NA 6.08E-11 mr1084 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970 NA 1.31E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970 NA 5.33E-13 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970 NA 1.16E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970 NA 1.68E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970 NA 1.34E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970 NA 3.50E-06 mr1295 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970 NA 1.78E-14 mr1330 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970 NA 5.21E-10 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970 NA 9.55E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970 NA 1.46E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970 NA 9.99E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970 NA 9.84E-09 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970 NA 1.36E-22 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970 NA 5.36E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970 NA 1.52E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970 NA 4.52E-11 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970 NA 1.72E-08 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970 NA 5.12E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970 NA 5.12E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970 NA 1.17E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970 NA 4.76E-21 mr1825 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970 NA 2.89E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970 NA 3.91E-07 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251