Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0520821970:

Variant ID: vg0520821970 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 20821970
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGAGGCACCTCTAATTTAAATGATAACATCTAATTTTTAATAATTAAAAGGTAACAAGTACTCCTCCCATTGTCCCGATTTGTTGTCTTATATATAGAGT[T/C]
ATAGGGCCGGTTCACTTTGATGCCAAAAAAAACTTACCAAATTGGCATTGCCAAAATTTTGGCATAGTTACCAAAATTTTGGTAACTTGCCAAAATTTTA

Reverse complement sequence

TAAAATTTTGGCAAGTTACCAAAATTTTGGTAACTATGCCAAAATTTTGGCAATGCCAATTTGGTAAGTTTTTTTTGGCATCAAAGTGAACCGGCCCTAT[A/G]
ACTCTATATATAAGACAACAAATCGGGACAATGGGAGGAGTACTTGTTACCTTTTAATTATTAAAAATTAGATGTTATCATTTAAATTAGAGGTGCCTCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.10%	19.40%	1.40%	0.04%	NA
All Indica	2759	99.30%	0.40%	0.18%	0.04%	NA
All Japonica	1512	44.00%	52.50%	3.51%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.30%	1.50%	0.22%	0.00%	NA
Indica III	913	99.70%	0.10%	0.11%	0.11%	NA
Indica Intermediate	786	99.10%	0.50%	0.38%	0.00%	NA
Temperate Japonica	767	74.20%	21.10%	4.69%	0.00%	NA
Tropical Japonica	504	2.00%	96.60%	1.39%	0.00%	NA
Japonica Intermediate	241	35.70%	60.20%	4.15%	0.00%	NA
VI/Aromatic	96	6.20%	91.70%	1.04%	1.04%	NA
Intermediate	90	65.60%	26.70%	7.78%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0520821970	T -> DEL	N	N	silent_mutation	Average:51.76; most accessible tissue: Callus, score: 82.287	N	N	N	N
vg0520821970	T -> C	LOC_Os05g35070.1	upstream_gene_variant ; 1190.0bp to feature; MODIFIER	silent_mutation	Average:51.76; most accessible tissue: Callus, score: 82.287	N	N	N	N
vg0520821970	T -> C	LOC_Os05g35070-LOC_Os05g35080	intergenic_region ; MODIFIER	silent_mutation	Average:51.76; most accessible tissue: Callus, score: 82.287	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0520821970	NA	8.67E-06	mr1077	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970	NA	6.08E-11	mr1084	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970	NA	1.31E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970	NA	5.33E-13	mr1205	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970	NA	1.16E-07	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970	NA	1.68E-07	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970	NA	1.34E-07	mr1271	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970	NA	3.50E-06	mr1295	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970	NA	1.78E-14	mr1330	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970	NA	5.21E-10	mr1332	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970	NA	9.55E-07	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970	NA	1.46E-06	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970	NA	9.99E-07	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970	NA	9.84E-09	mr1563	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970	NA	1.36E-22	mr1580	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970	NA	5.36E-06	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970	NA	1.52E-06	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970	NA	4.52E-11	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970	NA	1.72E-08	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970	NA	5.12E-07	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970	NA	5.12E-07	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970	NA	1.17E-07	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970	NA	4.76E-21	mr1825	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970	NA	2.89E-13	mr1552_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520821970	NA	3.91E-07	mr1554_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251