\
| Variant ID: vg0520747897 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 20747897 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGGAGACTCACCGGCAAAAGCACCAACTAGCCCTAACTACAGGAAGCACCTAACGACCTAATAACAGACCTAACCACACTACACTAGTAGGGGGAGGTGG[C/T]
CGGACCCCTCCTCCAACCCTCGCCGGCGGTGAACCGTTGGAATCTGGGGGAAGGAGGGGATGGGAGACGAGGGAGAGAGAGAAGCTACTGTAGAGAGGGG
CCCCTCTCTACAGTAGCTTCTCTCTCTCCCTCGTCTCCCATCCCCTCCTTCCCCCAGATTCCAACGGTTCACCGCCGGCGAGGGTTGGAGGAGGGGTCCG[G/A]
CCACCTCCCCCTACTAGTGTAGTGTGGTTAGGTCTGTTATTAGGTCGTTAGGTGCTTCCTGTAGTTAGGGCTAGTTGGTGCTTTTGCCGGTGAGTCTCCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.90% | 1.50% | 0.55% | 0.00% | NA |
| All Indica | 2759 | 96.50% | 2.60% | 0.91% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.00% | 0.50% | 1.51% | 0.00% | NA |
| Indica II | 465 | 97.80% | 1.70% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.50% | 6.70% | 1.78% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0520747897 | C -> T | LOC_Os05g34920.1 | upstream_gene_variant ; 974.0bp to feature; MODIFIER | silent_mutation | Average:75.141; most accessible tissue: Zhenshan97 young leaf, score: 84.814 | N | N | N | N |
| vg0520747897 | C -> T | LOC_Os05g34914-LOC_Os05g34920 | intergenic_region ; MODIFIER | silent_mutation | Average:75.141; most accessible tissue: Zhenshan97 young leaf, score: 84.814 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0520747897 | 8.97E-11 | 3.24E-11 | mr1238 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520747897 | 2.50E-06 | 1.98E-06 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520747897 | 6.25E-07 | 6.15E-07 | mr1841 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520747897 | 6.42E-08 | 4.71E-08 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520747897 | 1.85E-06 | 2.37E-06 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520747897 | 6.52E-08 | 1.80E-07 | mr1841_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520747897 | 7.90E-06 | NA | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |