\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0520747897:

Variant ID: vg0520747897 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 20747897
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGAGACTCACCGGCAAAAGCACCAACTAGCCCTAACTACAGGAAGCACCTAACGACCTAATAACAGACCTAACCACACTACACTAGTAGGGGGAGGTGG[C/T]
CGGACCCCTCCTCCAACCCTCGCCGGCGGTGAACCGTTGGAATCTGGGGGAAGGAGGGGATGGGAGACGAGGGAGAGAGAGAAGCTACTGTAGAGAGGGG

Reverse complement sequence

CCCCTCTCTACAGTAGCTTCTCTCTCTCCCTCGTCTCCCATCCCCTCCTTCCCCCAGATTCCAACGGTTCACCGCCGGCGAGGGTTGGAGGAGGGGTCCG[G/A]
CCACCTCCCCCTACTAGTGTAGTGTGGTTAGGTCTGTTATTAGGTCGTTAGGTGCTTCCTGTAGTTAGGGCTAGTTGGTGCTTTTGCCGGTGAGTCTCCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.90% 1.50% 0.55% 0.00% NA
All Indica  2759 96.50% 2.60% 0.91% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.00% 0.50% 1.51% 0.00% NA
Indica II  465 97.80% 1.70% 0.43% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 91.50% 6.70% 1.78% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0520747897 C -> T LOC_Os05g34920.1 upstream_gene_variant ; 974.0bp to feature; MODIFIER silent_mutation Average:75.141; most accessible tissue: Zhenshan97 young leaf, score: 84.814 N N N N
vg0520747897 C -> T LOC_Os05g34914-LOC_Os05g34920 intergenic_region ; MODIFIER silent_mutation Average:75.141; most accessible tissue: Zhenshan97 young leaf, score: 84.814 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0520747897 8.97E-11 3.24E-11 mr1238 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520747897 2.50E-06 1.98E-06 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520747897 6.25E-07 6.15E-07 mr1841 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520747897 6.42E-08 4.71E-08 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520747897 1.85E-06 2.37E-06 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520747897 6.52E-08 1.80E-07 mr1841_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520747897 7.90E-06 NA mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251