\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0520634158:

Variant ID: vg0520634158 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 20634158
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCCCTCCATCCCATAATAGGTGACGTTTTTGACTTTTTATTTGCAACGTTTGACCATTCGTTTTATTTGAAAAATTAGTGCAAATATAAAAAAAGATAA[G/A]
TCATATGTAAAGTACTTTTGATAATAAAGCAAATGACAAACAAAATAAATAATAATTCTAAATTTTTTTGAATAAGACGAATGATCAAACATTGACAAAC

Reverse complement sequence

GTTTGTCAATGTTTGATCATTCGTCTTATTCAAAAAAATTTAGAATTATTATTTATTTTGTTTGTCATTTGCTTTATTATCAAAAGTACTTTACATATGA[C/T]
TTATCTTTTTTTATATTTGCACTAATTTTTCAAATAAAACGAATGGTCAAACGTTGCAAATAAAAAGTCAAAAACGTCACCTATTATGGGATGGAGGGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.10% 6.80% 0.13% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 82.90% 16.80% 0.33% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 70.70% 28.70% 0.65% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 85.90% 14.10% 0.00% 0.00% NA
VI/Aromatic  96 39.60% 59.40% 1.04% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0520634158 G -> A LOC_Os05g34780.1 upstream_gene_variant ; 2224.0bp to feature; MODIFIER silent_mutation Average:62.163; most accessible tissue: Minghui63 flower, score: 76.594 N N N N
vg0520634158 G -> A LOC_Os05g34770.1 downstream_gene_variant ; 1708.0bp to feature; MODIFIER silent_mutation Average:62.163; most accessible tissue: Minghui63 flower, score: 76.594 N N N N
vg0520634158 G -> A LOC_Os05g34770-LOC_Os05g34780 intergenic_region ; MODIFIER silent_mutation Average:62.163; most accessible tissue: Minghui63 flower, score: 76.594 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0520634158 3.92E-06 NA mr1404 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520634158 NA 6.92E-06 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251