\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0520620361:

Variant ID: vg0520620361 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 20620361
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.79, A: 0.21, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


TTCACGCAAAACACACGTAATCAATCTAGGGTTTGCCTCCTCCTCTGTGTTGCGCCGTCACTCGTAGACTACTCCATCCCGCTCGCTGGCGTGCACCTGC[A/G]
ATCGGGAGAGCAGGTCTTCGGAACCTCTGCCTTCGACGTCCTGCACCGGGAGAAGGCGGCAATAAGGTTTTTGGGAAGCGCTTCGCGCGACTGCTCCCTG

Reverse complement sequence

CAGGGAGCAGTCGCGCGAAGCGCTTCCCAAAAACCTTATTGCCGCCTTCTCCCGGTGCAGGACGTCGAAGGCAGAGGTTCCGAAGACCTGCTCTCCCGAT[T/C]
GCAGGTGCACGCCAGCGAGCGGGATGGAGTAGTCTACGAGTGACGGCGCAACACAGAGGAGGAGGCAAACCCTAGATTGATTACGTGTGTTTTGCGTGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.40% 28.00% 0.49% 4.21% NA
All Indica  2759 97.80% 1.50% 0.14% 0.54% NA
All Japonica  1512 19.20% 80.70% 0.13% 0.00% NA
Aus  269 26.40% 0.40% 6.32% 66.91% NA
Indica I  595 98.80% 0.80% 0.17% 0.17% NA
Indica II  465 97.00% 2.40% 0.43% 0.22% NA
Indica III  913 97.90% 1.90% 0.00% 0.22% NA
Indica Intermediate  786 97.30% 1.10% 0.13% 1.40% NA
Temperate Japonica  767 32.60% 67.10% 0.26% 0.00% NA
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 15.40% 84.60% 0.00% 0.00% NA
VI/Aromatic  96 65.60% 32.30% 0.00% 2.08% NA
Intermediate  90 67.80% 30.00% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0520620361 A -> DEL N N silent_mutation Average:30.026; most accessible tissue: Zhenshan97 flower, score: 58.632 N N N N
vg0520620361 A -> G LOC_Os05g34760.1 upstream_gene_variant ; 562.0bp to feature; MODIFIER silent_mutation Average:30.026; most accessible tissue: Zhenshan97 flower, score: 58.632 N N N N
vg0520620361 A -> G LOC_Os05g34760.2 upstream_gene_variant ; 560.0bp to feature; MODIFIER silent_mutation Average:30.026; most accessible tissue: Zhenshan97 flower, score: 58.632 N N N N
vg0520620361 A -> G LOC_Os05g34750.1 downstream_gene_variant ; 1521.0bp to feature; MODIFIER silent_mutation Average:30.026; most accessible tissue: Zhenshan97 flower, score: 58.632 N N N N
vg0520620361 A -> G LOC_Os05g34750-LOC_Os05g34760 intergenic_region ; MODIFIER silent_mutation Average:30.026; most accessible tissue: Zhenshan97 flower, score: 58.632 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0520620361 NA 4.51E-10 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520620361 NA 1.14E-06 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520620361 NA 1.07E-16 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520620361 NA 2.80E-08 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520620361 NA 4.24E-18 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520620361 NA 2.86E-06 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520620361 NA 1.65E-15 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520620361 NA 1.70E-15 mr1938 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520620361 NA 4.33E-06 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520620361 NA 1.51E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520620361 NA 4.40E-06 mr1444_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520620361 NA 1.12E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251