\
| Variant ID: vg0520620361 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 20620361 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.79, A: 0.21, others allele: 0.00, population size: 89. )
TTCACGCAAAACACACGTAATCAATCTAGGGTTTGCCTCCTCCTCTGTGTTGCGCCGTCACTCGTAGACTACTCCATCCCGCTCGCTGGCGTGCACCTGC[A/G]
ATCGGGAGAGCAGGTCTTCGGAACCTCTGCCTTCGACGTCCTGCACCGGGAGAAGGCGGCAATAAGGTTTTTGGGAAGCGCTTCGCGCGACTGCTCCCTG
CAGGGAGCAGTCGCGCGAAGCGCTTCCCAAAAACCTTATTGCCGCCTTCTCCCGGTGCAGGACGTCGAAGGCAGAGGTTCCGAAGACCTGCTCTCCCGAT[T/C]
GCAGGTGCACGCCAGCGAGCGGGATGGAGTAGTCTACGAGTGACGGCGCAACACAGAGGAGGAGGCAAACCCTAGATTGATTACGTGTGTTTTGCGTGAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.40% | 28.00% | 0.49% | 4.21% | NA |
| All Indica | 2759 | 97.80% | 1.50% | 0.14% | 0.54% | NA |
| All Japonica | 1512 | 19.20% | 80.70% | 0.13% | 0.00% | NA |
| Aus | 269 | 26.40% | 0.40% | 6.32% | 66.91% | NA |
| Indica I | 595 | 98.80% | 0.80% | 0.17% | 0.17% | NA |
| Indica II | 465 | 97.00% | 2.40% | 0.43% | 0.22% | NA |
| Indica III | 913 | 97.90% | 1.90% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 97.30% | 1.10% | 0.13% | 1.40% | NA |
| Temperate Japonica | 767 | 32.60% | 67.10% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 0.60% | 99.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 15.40% | 84.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 65.60% | 32.30% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 67.80% | 30.00% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0520620361 | A -> DEL | N | N | silent_mutation | Average:30.026; most accessible tissue: Zhenshan97 flower, score: 58.632 | N | N | N | N |
| vg0520620361 | A -> G | LOC_Os05g34760.1 | upstream_gene_variant ; 562.0bp to feature; MODIFIER | silent_mutation | Average:30.026; most accessible tissue: Zhenshan97 flower, score: 58.632 | N | N | N | N |
| vg0520620361 | A -> G | LOC_Os05g34760.2 | upstream_gene_variant ; 560.0bp to feature; MODIFIER | silent_mutation | Average:30.026; most accessible tissue: Zhenshan97 flower, score: 58.632 | N | N | N | N |
| vg0520620361 | A -> G | LOC_Os05g34750.1 | downstream_gene_variant ; 1521.0bp to feature; MODIFIER | silent_mutation | Average:30.026; most accessible tissue: Zhenshan97 flower, score: 58.632 | N | N | N | N |
| vg0520620361 | A -> G | LOC_Os05g34750-LOC_Os05g34760 | intergenic_region ; MODIFIER | silent_mutation | Average:30.026; most accessible tissue: Zhenshan97 flower, score: 58.632 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0520620361 | NA | 4.51E-10 | mr1299 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520620361 | NA | 1.14E-06 | mr1321 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520620361 | NA | 1.07E-16 | mr1700 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520620361 | NA | 2.80E-08 | mr1756 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520620361 | NA | 4.24E-18 | mr1913 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520620361 | NA | 2.86E-06 | mr1913 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520620361 | NA | 1.65E-15 | mr1916 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520620361 | NA | 1.70E-15 | mr1938 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520620361 | NA | 4.33E-06 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520620361 | NA | 1.51E-06 | mr1358_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520620361 | NA | 4.40E-06 | mr1444_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520620361 | NA | 1.12E-13 | mr1552_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |