Search for Variation information by Variation ID:
Detailed information for vg0520618572:
| Variant ID: vg0520618572 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 20618572 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.17, others allele: 0.00, population size: 82. )
Flanking Sequence (100 bp) in Reference Genome:
ACACCTTATGATCCTAGCTTGTTGCTTCGCAAGAACAAGAGAATTGCTAGGAATCAACTGGAATACTCCCAAATCATTGGCTTGCTGATGTACCTGGCTA[A/G]
TGCAACTAGGCCTGATATCTCCTTTGCTGTGAGCAAGTTGAGCCGGTTTACCTCTAATCCGGGAGATGATCACTGGCGTGCACTTGAGCGAGTAATGCGC
Reverse complement sequence
GCGCATTACTCGCTCAAGTGCACGCCAGTGATCATCTCCCGGATTAGAGGTAAACCGGCTCAACTTGCTCACAGCAAAGGAGATATCAGGCCTAGTTGCA[T/C]
TAGCCAGGTACATCAGCAAGCCAATGATTTGGGAGTATTCCAGTTGATTCCTAGCAATTCTCTTGTTCTTGCGAAGCAACAAGCTAGGATCATAAGGTGT
Allele Frequencies:
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.00% | 20.30% | 41.68% | 0.00% | NA |
| All Indica | 2759 | 14.30% | 22.70% | 63.03% | 0.00% | NA |
| All Japonica | 1512 | 81.20% | 16.00% | 2.78% | 0.00% | NA |
| Aus | 269 | 37.50% | 15.20% | 47.21% | 0.00% | NA |
| Indica I | 595 | 6.60% | 23.90% | 69.58% | 0.00% | NA |
| Indica II | 465 | 11.00% | 32.90% | 56.13% | 0.00% | NA |
| Indica III | 913 | 20.40% | 19.40% | 60.24% | 0.00% | NA |
| Indica Intermediate | 786 | 15.00% | 19.60% | 65.39% | 0.00% | NA |
| Temperate Japonica | 767 | 68.10% | 27.20% | 4.69% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.20% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.10% | 13.30% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 39.60% | 30.20% | 30.21% | 0.00% | NA |
| Intermediate | 90 | 41.10% | 22.20% | 36.67% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0520618572 | A -> G | LOC_Os05g34750.1 | missense_variant ; p.Asn876Ser; MODERATE | nonsynonymous_codon | Average:13.083; most accessible tissue: Minghui63 flower, score: 18.795 | benign  |
-0.26 |
TOLERATED | 1.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0520618572 | NA | 6.03E-14 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520618572 | NA | 2.65E-13 | mr1905 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520618572 | NA | 1.40E-17 | mr1913 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520618572 | NA | 2.86E-06 | mr1913 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520618572 | NA | 2.17E-11 | mr1938 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520618572 | NA | 5.65E-20 | mr1062_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520618572 | NA | 4.33E-06 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520618572 | NA | 1.04E-06 | mr1321_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |