\
| Variant ID: vg0520600456 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 20600456 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AACATTGTGGGCGCTATGTGCGAAATAATGGCCCTATTTGGTAATGTACTCCCTCCTTCCCAAAATAAAAGACTTTGTTCAGATTTGTTGTTCTGTGATG[G/A]
GTCACATCTTATTCTATATTAAGTTATTTTGGGATGGAGGGAGTATGTTATTAAAATATTTTTTATTTTTTGACCTAGCTTCATGGTTAATATGTTGTTT
AAACAACATATTAACCATGAAGCTAGGTCAAAAAATAAAAAATATTTTAATAACATACTCCCTCCATCCCAAAATAACTTAATATAGAATAAGATGTGAC[C/T]
CATCACAGAACAACAAATCTGAACAAAGTCTTTTATTTTGGGAAGGAGGGAGTACATTACCAAATAGGGCCATTATTTCGCACATAGCGCCCACAATGTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.20% | 43.60% | 0.11% | 0.08% | NA |
| All Indica | 2759 | 92.30% | 7.50% | 0.14% | 0.11% | NA |
| All Japonica | 1512 | 2.20% | 97.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.90% | 5.70% | 0.34% | 0.00% | NA |
| Indica II | 465 | 89.00% | 10.80% | 0.00% | 0.22% | NA |
| Indica III | 913 | 93.40% | 6.50% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 91.60% | 8.00% | 0.25% | 0.13% | NA |
| Temperate Japonica | 767 | 3.80% | 96.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 96.90% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 50.00% | 48.90% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0520600456 | G -> DEL | N | N | silent_mutation | Average:66.979; most accessible tissue: Callus, score: 90.854 | N | N | N | N |
| vg0520600456 | G -> A | LOC_Os05g34740.1 | upstream_gene_variant ; 4887.0bp to feature; MODIFIER | silent_mutation | Average:66.979; most accessible tissue: Callus, score: 90.854 | N | N | N | N |
| vg0520600456 | G -> A | LOC_Os05g34720.1 | downstream_gene_variant ; 1629.0bp to feature; MODIFIER | silent_mutation | Average:66.979; most accessible tissue: Callus, score: 90.854 | N | N | N | N |
| vg0520600456 | G -> A | LOC_Os05g34730.1 | downstream_gene_variant ; 805.0bp to feature; MODIFIER | silent_mutation | Average:66.979; most accessible tissue: Callus, score: 90.854 | N | N | N | N |
| vg0520600456 | G -> A | LOC_Os05g34720-LOC_Os05g34730 | intergenic_region ; MODIFIER | silent_mutation | Average:66.979; most accessible tissue: Callus, score: 90.854 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0520600456 | NA | 1.31E-33 | mr1026 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520600456 | NA | 1.09E-34 | mr1161 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520600456 | NA | 2.58E-14 | mr1261 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520600456 | NA | 1.38E-10 | mr1316 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520600456 | 4.34E-06 | 4.34E-06 | mr1428 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520600456 | NA | 4.23E-25 | mr1537 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520600456 | NA | 1.86E-20 | mr1541 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520600456 | NA | 6.91E-13 | mr1657 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520600456 | NA | 4.56E-59 | mr1109_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520600456 | NA | 9.42E-20 | mr1255_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520600456 | NA | 5.18E-30 | mr1270_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520600456 | NA | 7.64E-24 | mr1316_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520600456 | NA | 1.55E-09 | mr1649_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520600456 | NA | 7.17E-15 | mr1720_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520600456 | NA | 1.62E-31 | mr1913_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520600456 | NA | 4.18E-30 | mr1932_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |