\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0520595366:

Variant ID: vg0520595366 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 20595366
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.75, C: 0.25, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


TGAATATATAAACTTATTTAAATTTTACATGCTGATGATTTGTTCTTACTTTTTTTTAATAATTACAAAATATATATGAAGAGGTGTTTCAATAGAAAGG[A/C]
TTGCAAGCCAAATGAGCCGAGCCGAACTTAAGTTTTAGCTTATTTCCCTAACTGAGCTGAGCCAAGCCAATCCAAGCCTTTTTTTTTTTTTTTGAGAGCC

Reverse complement sequence

GGCTCTCAAAAAAAAAAAAAAAGGCTTGGATTGGCTTGGCTCAGCTCAGTTAGGGAAATAAGCTAAAACTTAAGTTCGGCTCGGCTCATTTGGCTTGCAA[T/G]
CCTTTCTATTGAAACACCTCTTCATATATATTTTGTAATTATTAAAAAAAAGTAAGAACAAATCATCAGCATGTAAAATTTAAATAAGTTTATATATTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.10% 37.70% 0.19% 0.00% NA
All Indica  2759 93.40% 6.40% 0.18% 0.00% NA
All Japonica  1512 2.30% 97.60% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 93.90% 5.70% 0.34% 0.00% NA
Indica II  465 88.80% 11.20% 0.00% 0.00% NA
Indica III  913 94.50% 5.50% 0.00% 0.00% NA
Indica Intermediate  786 94.50% 5.10% 0.38% 0.00% NA
Temperate Japonica  767 3.80% 96.20% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 99.20% 0.20% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 52.20% 44.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0520595366 A -> C LOC_Os05g34720.1 upstream_gene_variant ; 307.0bp to feature; MODIFIER silent_mutation Average:86.824; most accessible tissue: Minghui63 flower, score: 91.425 N N N N
vg0520595366 A -> C LOC_Os05g34700.1 downstream_gene_variant ; 4415.0bp to feature; MODIFIER silent_mutation Average:86.824; most accessible tissue: Minghui63 flower, score: 91.425 N N N N
vg0520595366 A -> C LOC_Os05g34710.1 downstream_gene_variant ; 3054.0bp to feature; MODIFIER silent_mutation Average:86.824; most accessible tissue: Minghui63 flower, score: 91.425 N N N N
vg0520595366 A -> C LOC_Os05g34710-LOC_Os05g34720 intergenic_region ; MODIFIER silent_mutation Average:86.824; most accessible tissue: Minghui63 flower, score: 91.425 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0520595366 A C -0.01 -0.03 -0.02 -0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0520595366 NA 1.78E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520595366 NA 2.64E-73 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520595366 NA 1.94E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520595366 NA 5.58E-13 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520595366 NA 2.23E-56 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520595366 NA 8.69E-42 mr1645 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520595366 NA 8.51E-33 mr1647 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520595366 NA 3.13E-09 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520595366 NA 1.30E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520595366 NA 3.38E-39 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520595366 NA 1.08E-18 mr1281_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520595366 NA 2.83E-19 mr1416_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520595366 NA 2.78E-41 mr1541_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520595366 NA 6.19E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520595366 NA 2.99E-08 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520595366 NA 2.33E-07 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520595366 NA 2.66E-17 mr1874_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520595366 NA 1.34E-35 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520595366 NA 7.92E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251