Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0520594830:

Variant ID: vg0520594830 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 20594830
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.05, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

TCCACATTTGCTTCTAGGGTTGTATGGAGGAATTAAATAATGTCCTTTGGACCCTAGGACCAAAGACTTGGTGGCGAACATAGTATTAAGATAATATTCC[G/A]
TCGAATACAAATTATAGTTCTTTTGATTATGCAATCGATGGAGAAAATGGTAGTAATCCTGCACCATTCTGCTATGGACGCAAAACTTGGTAAGACTTCA

Reverse complement sequence

TGAAGTCTTACCAAGTTTTGCGTCCATAGCAGAATGGTGCAGGATTACTACCATTTTCTCCATCGATTGCATAATCAAAAGAACTATAATTTGTATTCGA[C/T]
GGAATATTATCTTAATACTATGTTCGCCACCAAGTCTTTGGTCCTAGGGTCCAAAGGACATTATTTAATTCCTCCATACAACCCTAGAAGCAAATGTGGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.30%	35.70%	1.14%	0.89%	NA
All Indica	2759	93.70%	3.00%	1.85%	1.45%	NA
All Japonica	1512	2.20%	97.80%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	93.80%	0.30%	0.17%	5.71%	NA
Indica II	465	89.20%	8.60%	2.15%	0.00%	NA
Indica III	913	94.50%	2.70%	2.52%	0.22%	NA
Indica Intermediate	786	95.40%	1.90%	2.16%	0.51%	NA
Temperate Japonica	767	3.80%	96.20%	0.00%	0.00%	NA
Tropical Japonica	504	0.60%	99.40%	0.00%	0.00%	NA
Japonica Intermediate	241	0.80%	99.20%	0.00%	0.00%	NA
VI/Aromatic	96	5.20%	92.70%	1.04%	1.04%	NA
Intermediate	90	54.40%	42.20%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0520594830	G -> DEL	N	N	silent_mutation	Average:55.336; most accessible tissue: Callus, score: 73.604	N	N	N	N
vg0520594830	G -> A	LOC_Os05g34720.1	upstream_gene_variant ; 843.0bp to feature; MODIFIER	silent_mutation	Average:55.336; most accessible tissue: Callus, score: 73.604	N	N	N	N
vg0520594830	G -> A	LOC_Os05g34700.1	downstream_gene_variant ; 3879.0bp to feature; MODIFIER	silent_mutation	Average:55.336; most accessible tissue: Callus, score: 73.604	N	N	N	N
vg0520594830	G -> A	LOC_Os05g34710.1	downstream_gene_variant ; 2518.0bp to feature; MODIFIER	silent_mutation	Average:55.336; most accessible tissue: Callus, score: 73.604	N	N	N	N
vg0520594830	G -> A	LOC_Os05g34710-LOC_Os05g34720	intergenic_region ; MODIFIER	silent_mutation	Average:55.336; most accessible tissue: Callus, score: 73.604	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0520594830	NA	1.94E-09	mr1005	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520594830	NA	1.02E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520594830	NA	5.93E-39	mr1645	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520594830	NA	1.96E-06	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520594830	NA	8.58E-39	mr1891	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520594830	NA	3.77E-18	mr1281_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520594830	NA	1.98E-17	mr1416_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520594830	NA	1.23E-41	mr1541_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520594830	NA	8.01E-06	mr1541_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520594830	NA	1.20E-10	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520594830	NA	8.58E-09	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520594830	NA	3.09E-19	mr1637_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520594830	NA	8.59E-23	mr1708_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520594830	NA	1.97E-14	mr1790_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520594830	NA	5.79E-37	mr1888_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520594830	NA	9.70E-31	mr1891_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520594830	NA	7.25E-09	mr1947_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520594830	NA	6.80E-06	mr1982_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251