Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0520584620:

Variant ID: vg0520584620 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 20584620
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


GGTTCTCCGGGTGTCGTTCTGTTGAAGTTGAAGGAGATGAAGCGGCCCATGCAATCACGTTCCATCGTCGTTGGCCTTTCCACAAGCTCTCTCTCCTCGC[G/A]
GCGACGGAGTTGAGAGTACTTGTAGCGGTCACAGGGCCATCATGCACTGTCGGGCAATAGAGAGAGGAGAAGAGAGAGAAAGAAAAGAGGGGTAGAGCAA

Reverse complement sequence

TTGCTCTACCCCTCTTTTCTTTCTCTCTCTTCTCCTCTCTCTATTGCCCGACAGTGCATGATGGCCCTGTGACCGCTACAAGTACTCTCAACTCCGTCGC[C/T]
GCGAGGAGAGAGAGCTTGTGGAAAGGCCAACGACGATGGAACGTGATTGCATGGGCCGCTTCATCTCCTTCAACTTCAACAGAACGACACCCGGAGAACC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.30% 43.30% 0.15% 0.23% NA
All Indica  2759 92.40% 7.20% 0.18% 0.29% NA
All Japonica  1512 2.30% 97.50% 0.13% 0.07% NA
Aus  269 10.00% 90.00% 0.00% 0.00% NA
Indica I  595 93.60% 6.10% 0.17% 0.17% NA
Indica II  465 89.00% 10.50% 0.00% 0.43% NA
Indica III  913 93.30% 6.20% 0.22% 0.22% NA
Indica Intermediate  786 92.20% 7.10% 0.25% 0.38% NA
Temperate Japonica  767 3.90% 96.00% 0.00% 0.13% NA
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 98.30% 0.83% 0.00% NA
VI/Aromatic  96 2.10% 96.90% 0.00% 1.04% NA
Intermediate  90 53.30% 45.60% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0520584620 G -> DEL LOC_Os05g34690.1 N frameshift_variant Average:80.932; most accessible tissue: Zhenshan97 panicle, score: 95.654 N N N N
vg0520584620 G -> A LOC_Os05g34690.1 synonymous_variant ; p.Ala87Ala; LOW synonymous_codon Average:80.932; most accessible tissue: Zhenshan97 panicle, score: 95.654 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0520584620 G A 0.03 0.01 0.01 0.12 0.1 0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0520584620 NA 4.92E-33 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520584620 NA 1.73E-14 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520584620 NA 3.58E-10 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520584620 NA 1.92E-24 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520584620 NA 8.39E-21 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520584620 NA 9.33E-12 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520584620 NA 1.05E-11 mr1883 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520584620 NA 4.14E-21 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520584620 NA 7.88E-60 mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520584620 NA 4.62E-35 mr1181_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520584620 NA 1.61E-20 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520584620 NA 7.14E-34 mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520584620 NA 1.34E-30 mr1270_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520584620 NA 1.21E-25 mr1316_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520584620 NA 1.78E-21 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520584620 NA 2.64E-10 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520584620 NA 3.92E-15 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520584620 NA 1.08E-30 mr1932_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520584620 NA 7.27E-14 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251