Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0520578454:

Variant ID: vg0520578454 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 20578454
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 182. )

Flanking Sequence (100 bp) in Reference Genome:


AATTTGGTTGTCAGTCGCAGTGTGACACGTTTAAAATTAGACGAGTTTGATCACTTAGCAGATATATATATTTGATTGAAGTCACAGCGTGACAAGATTT[T/G]
TTTCTAACAAAATATATGTTATACATACTTATATATGTCAATGACTAAAAACACTATGATAAGATTCTTTTAAACTTGTTAAGGTGTGACATATAATTTA

Reverse complement sequence

TAAATTATATGTCACACCTTAACAAGTTTAAAAGAATCTTATCATAGTGTTTTTAGTCATTGACATATATAAGTATGTATAACATATATTTTGTTAGAAA[A/C]
AAATCTTGTCACGCTGTGACTTCAATCAAATATATATATCTGCTAAGTGATCAAACTCGTCTAATTTTAAACGTGTCACACTGCGACTGACAACCAAATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.70% 43.20% 0.11% 0.00% NA
All Indica  2759 93.10% 6.80% 0.14% 0.00% NA
All Japonica  1512 2.20% 97.80% 0.00% 0.00% NA
Aus  269 10.00% 90.00% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 89.00% 11.00% 0.00% 0.00% NA
Indica III  913 92.00% 7.90% 0.11% 0.00% NA
Indica Intermediate  786 92.00% 7.60% 0.38% 0.00% NA
Temperate Japonica  767 3.80% 96.20% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 96.90% 1.04% 0.00% NA
Intermediate  90 53.30% 46.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0520578454 T -> G LOC_Os05g34670.1 upstream_gene_variant ; 4787.0bp to feature; MODIFIER silent_mutation Average:80.064; most accessible tissue: Callus, score: 93.543 N N N N
vg0520578454 T -> G LOC_Os05g34680.1 downstream_gene_variant ; 2588.0bp to feature; MODIFIER silent_mutation Average:80.064; most accessible tissue: Callus, score: 93.543 N N N N
vg0520578454 T -> G LOC_Os05g34680.2 downstream_gene_variant ; 3333.0bp to feature; MODIFIER silent_mutation Average:80.064; most accessible tissue: Callus, score: 93.543 N N N N
vg0520578454 T -> G LOC_Os05g34670-LOC_Os05g34680 intergenic_region ; MODIFIER silent_mutation Average:80.064; most accessible tissue: Callus, score: 93.543 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0520578454 T G 0.0 0.0 -0.01 -0.01 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0520578454 NA 4.01E-33 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520578454 NA 8.74E-53 mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520578454 NA 2.14E-35 mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520578454 NA 3.17E-34 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520578454 NA 1.06E-18 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520578454 NA 3.76E-31 mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520578454 NA 1.15E-14 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520578454 NA 3.60E-36 mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520578454 NA 3.89E-24 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520578454 NA 1.68E-11 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520578454 NA 1.15E-21 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520578454 NA 2.21E-50 mr1089_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520578454 NA 2.26E-66 mr1109_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520578454 NA 3.28E-38 mr1129_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520578454 NA 5.02E-39 mr1251_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520578454 NA 3.19E-22 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520578454 NA 4.65E-36 mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520578454 NA 1.43E-29 mr1270_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520578454 NA 2.21E-24 mr1316_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520578454 NA 2.82E-39 mr1435_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520578454 NA 2.27E-09 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520578454 NA 9.66E-16 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520578454 NA 1.79E-32 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520578454 NA 1.98E-31 mr1932_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251