\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0520505270:

Variant ID: vg0520505270 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 20505270
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTAATAACGTTTAAAAATGGTAAATTTATAAAGGACACACACAATCAAAATTGAACCGTCTTGCGGAGCCCAGTTGACTCTGCCCCTACATAGCCCAC[G/A]
TCACCTTGCCACATGTGGGCCGATCCAAGCACACATCTCAAAGAATATCTAACGACCAAAAAAATCGCATGATGCAGACCACAGAAATCTGTCGACAACT

Reverse complement sequence

AGTTGTCGACAGATTTCTGTGGTCTGCATCATGCGATTTTTTTGGTCGTTAGATATTCTTTGAGATGTGTGCTTGGATCGGCCCACATGTGGCAAGGTGA[C/T]
GTGGGCTATGTAGGGGCAGAGTCAACTGGGCTCCGCAAGACGGTTCAATTTTGATTGTGTGTGTCCTTTATAAATTTACCATTTTTAAACGTTATTAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.00% 6.00% 0.00% 0.00% NA
All Indica  2759 98.80% 1.20% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 10.40% 89.60% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 98.60% 1.40% 0.00% 0.00% NA
Indica Intermediate  786 97.50% 2.50% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0520505270 G -> A LOC_Os05g34570.1 upstream_gene_variant ; 3578.0bp to feature; MODIFIER silent_mutation Average:56.043; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0520505270 G -> A LOC_Os05g34590.1 upstream_gene_variant ; 2000.0bp to feature; MODIFIER silent_mutation Average:56.043; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0520505270 G -> A LOC_Os05g34580.1 downstream_gene_variant ; 475.0bp to feature; MODIFIER silent_mutation Average:56.043; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0520505270 G -> A LOC_Os05g34580-LOC_Os05g34590 intergenic_region ; MODIFIER silent_mutation Average:56.043; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0520505270 NA 2.37E-13 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 NA 6.18E-16 mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 NA 2.04E-19 mr1515 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 NA 9.80E-38 mr1549 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 NA 1.06E-07 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 NA 1.63E-25 mr1858 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 NA 1.51E-25 mr1859 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 NA 8.52E-25 mr1868 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 NA 2.77E-12 mr1897 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 NA 1.11E-10 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 NA 6.45E-20 mr1095_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 NA 1.00E-32 mr1098_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 NA 1.06E-24 mr1099_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 NA 7.09E-17 mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 NA 2.63E-19 mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 NA 3.00E-17 mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 NA 1.08E-23 mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 NA 5.10E-24 mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 NA 3.69E-09 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 NA 1.80E-18 mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 NA 2.28E-24 mr1247_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 NA 1.02E-22 mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 NA 7.52E-13 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 NA 7.31E-15 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 NA 2.95E-31 mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 NA 1.90E-44 mr1550_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 NA 2.30E-16 mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 NA 2.34E-11 mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 6.65E-07 NA mr1622_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 NA 3.34E-29 mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 NA 2.90E-13 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 NA 4.15E-13 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 NA 8.65E-12 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 NA 2.40E-12 mr1918_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 NA 1.88E-17 mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520505270 NA 6.58E-16 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251