Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0520503574:

Variant ID: vg0520503574 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 20503574
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CACGGAAGCCTCAAGCACTGAATTTCGAGAATATATATATTTTTTTATGAAACACATAAACACGCTCACAACACGAGCATTGAGATTGACGAAGTCACCA[C/T]
GGAAGCCTCAAGCACCCGTGTCAAATCAAAGATTTGAATCCAGATTGACTGGTTCCACCACAAGAAACTATGGGAATATACATGTGTATGTTGTCTGAAA

Reverse complement sequence

TTTCAGACAACATACACATGTATATTCCCATAGTTTCTTGTGGTGGAACCAGTCAATCTGGATTCAAATCTTTGATTTGACACGGGTGCTTGAGGCTTCC[G/A]
TGGTGACTTCGTCAATCTCAATGCTCGTGTTGTGAGCGTGTTTATGTGTTTCATAAAAAAATATATATATTCTCGAAATTCAGTGCTTGAGGCTTCCGTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.90%	3.00%	4.23%	0.89%	NA
All Indica	2759	97.40%	2.00%	0.62%	0.00%	NA
All Japonica	1512	81.00%	5.40%	10.85%	2.78%	NA
Aus	269	98.90%	0.00%	1.12%	0.00%	NA
Indica I	595	97.10%	2.50%	0.34%	0.00%	NA
Indica II	465	97.60%	1.50%	0.86%	0.00%	NA
Indica III	913	97.20%	2.40%	0.44%	0.00%	NA
Indica Intermediate	786	97.80%	1.30%	0.89%	0.00%	NA
Temperate Japonica	767	79.50%	9.00%	10.82%	0.65%	NA
Tropical Japonica	504	92.90%	0.60%	3.57%	2.98%	NA
Japonica Intermediate	241	61.00%	3.70%	26.14%	9.13%	NA
VI/Aromatic	96	83.30%	3.10%	13.54%	0.00%	NA
Intermediate	90	94.40%	2.20%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0520503574	C -> T	LOC_Os05g34570.1	upstream_gene_variant ; 1882.0bp to feature; MODIFIER	silent_mutation	Average:22.87; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0520503574	C -> T	LOC_Os05g34580.1	upstream_gene_variant ; 576.0bp to feature; MODIFIER	silent_mutation	Average:22.87; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0520503574	C -> T	LOC_Os05g34590.1	upstream_gene_variant ; 3696.0bp to feature; MODIFIER	silent_mutation	Average:22.87; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0520503574	C -> T	LOC_Os05g34570-LOC_Os05g34580	intergenic_region ; MODIFIER	silent_mutation	Average:22.87; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg0520503574	C -> DEL	N	N	silent_mutation	Average:22.87; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0520503574	NA	1.85E-06	mr1069	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520503574	3.90E-06	NA	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520503574	NA	1.59E-06	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520503574	NA	3.33E-06	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520503574	1.86E-07	NA	mr1617	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520503574	NA	6.37E-06	mr1807	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251