\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0520503574:

Variant ID: vg0520503574 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 20503574
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACGGAAGCCTCAAGCACTGAATTTCGAGAATATATATATTTTTTTATGAAACACATAAACACGCTCACAACACGAGCATTGAGATTGACGAAGTCACCA[C/T]
GGAAGCCTCAAGCACCCGTGTCAAATCAAAGATTTGAATCCAGATTGACTGGTTCCACCACAAGAAACTATGGGAATATACATGTGTATGTTGTCTGAAA

Reverse complement sequence

TTTCAGACAACATACACATGTATATTCCCATAGTTTCTTGTGGTGGAACCAGTCAATCTGGATTCAAATCTTTGATTTGACACGGGTGCTTGAGGCTTCC[G/A]
TGGTGACTTCGTCAATCTCAATGCTCGTGTTGTGAGCGTGTTTATGTGTTTCATAAAAAAATATATATATTCTCGAAATTCAGTGCTTGAGGCTTCCGTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.90% 3.00% 4.23% 0.89% NA
All Indica  2759 97.40% 2.00% 0.62% 0.00% NA
All Japonica  1512 81.00% 5.40% 10.85% 2.78% NA
Aus  269 98.90% 0.00% 1.12% 0.00% NA
Indica I  595 97.10% 2.50% 0.34% 0.00% NA
Indica II  465 97.60% 1.50% 0.86% 0.00% NA
Indica III  913 97.20% 2.40% 0.44% 0.00% NA
Indica Intermediate  786 97.80% 1.30% 0.89% 0.00% NA
Temperate Japonica  767 79.50% 9.00% 10.82% 0.65% NA
Tropical Japonica  504 92.90% 0.60% 3.57% 2.98% NA
Japonica Intermediate  241 61.00% 3.70% 26.14% 9.13% NA
VI/Aromatic  96 83.30% 3.10% 13.54% 0.00% NA
Intermediate  90 94.40% 2.20% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0520503574 C -> T LOC_Os05g34570.1 upstream_gene_variant ; 1882.0bp to feature; MODIFIER silent_mutation Average:22.87; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0520503574 C -> T LOC_Os05g34580.1 upstream_gene_variant ; 576.0bp to feature; MODIFIER silent_mutation Average:22.87; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0520503574 C -> T LOC_Os05g34590.1 upstream_gene_variant ; 3696.0bp to feature; MODIFIER silent_mutation Average:22.87; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0520503574 C -> T LOC_Os05g34570-LOC_Os05g34580 intergenic_region ; MODIFIER silent_mutation Average:22.87; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0520503574 C -> DEL N N silent_mutation Average:22.87; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0520503574 NA 1.85E-06 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520503574 3.90E-06 NA mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520503574 NA 1.59E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520503574 NA 3.33E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520503574 1.86E-07 NA mr1617 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520503574 NA 6.37E-06 mr1807 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251