\
| Variant ID: vg0520503574 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 20503574 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CACGGAAGCCTCAAGCACTGAATTTCGAGAATATATATATTTTTTTATGAAACACATAAACACGCTCACAACACGAGCATTGAGATTGACGAAGTCACCA[C/T]
GGAAGCCTCAAGCACCCGTGTCAAATCAAAGATTTGAATCCAGATTGACTGGTTCCACCACAAGAAACTATGGGAATATACATGTGTATGTTGTCTGAAA
TTTCAGACAACATACACATGTATATTCCCATAGTTTCTTGTGGTGGAACCAGTCAATCTGGATTCAAATCTTTGATTTGACACGGGTGCTTGAGGCTTCC[G/A]
TGGTGACTTCGTCAATCTCAATGCTCGTGTTGTGAGCGTGTTTATGTGTTTCATAAAAAAATATATATATTCTCGAAATTCAGTGCTTGAGGCTTCCGTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.90% | 3.00% | 4.23% | 0.89% | NA |
| All Indica | 2759 | 97.40% | 2.00% | 0.62% | 0.00% | NA |
| All Japonica | 1512 | 81.00% | 5.40% | 10.85% | 2.78% | NA |
| Aus | 269 | 98.90% | 0.00% | 1.12% | 0.00% | NA |
| Indica I | 595 | 97.10% | 2.50% | 0.34% | 0.00% | NA |
| Indica II | 465 | 97.60% | 1.50% | 0.86% | 0.00% | NA |
| Indica III | 913 | 97.20% | 2.40% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 97.80% | 1.30% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 79.50% | 9.00% | 10.82% | 0.65% | NA |
| Tropical Japonica | 504 | 92.90% | 0.60% | 3.57% | 2.98% | NA |
| Japonica Intermediate | 241 | 61.00% | 3.70% | 26.14% | 9.13% | NA |
| VI/Aromatic | 96 | 83.30% | 3.10% | 13.54% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 2.20% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0520503574 | C -> T | LOC_Os05g34570.1 | upstream_gene_variant ; 1882.0bp to feature; MODIFIER | silent_mutation | Average:22.87; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0520503574 | C -> T | LOC_Os05g34580.1 | upstream_gene_variant ; 576.0bp to feature; MODIFIER | silent_mutation | Average:22.87; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0520503574 | C -> T | LOC_Os05g34590.1 | upstream_gene_variant ; 3696.0bp to feature; MODIFIER | silent_mutation | Average:22.87; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0520503574 | C -> T | LOC_Os05g34570-LOC_Os05g34580 | intergenic_region ; MODIFIER | silent_mutation | Average:22.87; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg0520503574 | C -> DEL | N | N | silent_mutation | Average:22.87; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0520503574 | NA | 1.85E-06 | mr1069 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520503574 | 3.90E-06 | NA | mr1137 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520503574 | NA | 1.59E-06 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520503574 | NA | 3.33E-06 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520503574 | 1.86E-07 | NA | mr1617 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0520503574 | NA | 6.37E-06 | mr1807 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |