Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0520398639:

Variant ID: vg0520398639 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 20398639
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCCTCGTGTTCGTCCTGGATGCTCAGGAGTCTGCAGGGCGAGTGACAGCTCGTCCTTCTCTCTGTCAGGTCGGAACGTGCCCTGAGAAGAGGCTTCCACT[G/A]
CGTCCGTTAGTCGACTCGCAGCCTCGCGTATCTGATCGCTGAAGACCAAGGAGCCATCAACTGGGTTGAGCGTTCCACCGTGAGTATAGTACCAGAACTT

Reverse complement sequence

AAGTTCTGGTACTATACTCACGGTGGAACGCTCAACCCAGTTGATGGCTCCTTGGTCTTCAGCGATCAGATACGCGAGGCTGCGAGTCGACTAACGGACG[C/T]
AGTGGAAGCCTCTTCTCAGGGCACGTTCCGACCTGACAGAGAGAAGGACGAGCTGTCACTCGCCCTGCAGACTCCTGAGCATCCAGGACGAACACGAGGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.40%	26.30%	0.23%	0.06%	NA
All Indica	2759	93.70%	6.20%	0.00%	0.07%	NA
All Japonica	1512	36.60%	62.90%	0.40%	0.07%	NA
Aus	269	97.40%	2.60%	0.00%	0.00%	NA
Indica I	595	98.20%	1.80%	0.00%	0.00%	NA
Indica II	465	96.60%	3.40%	0.00%	0.00%	NA
Indica III	913	90.40%	9.50%	0.00%	0.11%	NA
Indica Intermediate	786	92.50%	7.40%	0.00%	0.13%	NA
Temperate Japonica	767	5.20%	94.10%	0.65%	0.00%	NA
Tropical Japonica	504	92.10%	7.90%	0.00%	0.00%	NA
Japonica Intermediate	241	20.70%	78.40%	0.41%	0.41%	NA
VI/Aromatic	96	4.20%	94.80%	1.04%	0.00%	NA
Intermediate	90	72.20%	23.30%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0520398639	G -> DEL	LOC_Os05g34420.1	N	frameshift_variant	Average:26.441; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0520398639	G -> A	LOC_Os05g34420.1	missense_variant ; p.Ala198Val; MODERATE	nonsynonymous_codon ; A198I	Average:26.441; most accessible tissue: Zhenshan97 panicle, score: 43.098	benign	0.469	DELETERIOUS	0.00
vg0520398639	G -> A	LOC_Os05g34420.1	missense_variant ; p.Ala198Val; MODERATE	nonsynonymous_codon ; A198V	Average:26.441; most accessible tissue: Zhenshan97 panicle, score: 43.098	benign	0.287	DELETERIOUS	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0520398639	NA	1.56E-09	mr1089	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520398639	NA	2.12E-08	mr1129	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520398639	5.19E-06	NA	mr1143	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520398639	NA	1.16E-08	mr1271	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520398639	NA	4.41E-07	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520398639	2.52E-06	NA	mr1535	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520398639	NA	1.30E-16	mr1593	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520398639	NA	7.08E-06	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520398639	NA	3.25E-09	mr1679	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520398639	NA	3.21E-16	mr1699	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520398639	NA	8.78E-16	mr1732	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520398639	NA	2.50E-08	mr1742	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520398639	NA	2.72E-06	mr1892	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520398639	NA	3.98E-11	mr1089_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520398639	NA	2.04E-10	mr1093_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520398639	NA	1.05E-06	mr1097_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520398639	NA	4.80E-06	mr1129_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520398639	NA	6.50E-10	mr1235_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520398639	NA	8.28E-07	mr1250_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520398639	NA	1.35E-08	mr1251_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520398639	NA	2.49E-07	mr1257_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520398639	NA	2.29E-06	mr1295_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520398639	NA	1.80E-07	mr1423_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520398639	NA	1.44E-08	mr1435_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520398639	NA	1.59E-24	mr1593_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520398639	NA	7.86E-08	mr1599_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520398639	NA	1.83E-08	mr1679_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520398639	NA	3.34E-07	mr1733_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520398639	NA	6.68E-07	mr1807_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251