Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0520272415:

Variant ID: vg0520272415 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 20272415
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AACCCTGACAGTAGCCCCCGACTTCAATGCAAATGAGCGAGTTCATATTCTCAACTGCAGACCTTGGAGGAACTGTTATCGAGCTTACGTGACCGTTCTC[G/A]
GTGAGTTCAAAGATAACATTAGACTTCCTTTATCAGCCTCGTGCGGGCACCTAAAGGGTTTGTCTGAGTCAATCTCCGACGTCAACCAAGAAAGTAGCAG

Reverse complement sequence

CTGCTACTTTCTTGGTTGACGTCGGAGATTGACTCAGACAAACCCTTTAGGTGCCCGCACGAGGCTGATAAAGGAAGTCTAATGTTATCTTTGAACTCAC[C/T]
GAGAACGGTCACGTAAGCTCGATAACAGTTCCTCCAAGGTCTGCAGTTGAGAATATGAACTCGCTCATTTGCATTGAAGTCGGGGGCTACTGTCAGGGTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.40%	41.50%	0.08%	0.00%	NA
All Indica	2759	96.10%	3.80%	0.11%	0.00%	NA
All Japonica	1512	2.40%	97.50%	0.07%	0.00%	NA
Aus	269	10.00%	90.00%	0.00%	0.00%	NA
Indica I	595	97.10%	2.70%	0.17%	0.00%	NA
Indica II	465	96.60%	3.40%	0.00%	0.00%	NA
Indica III	913	98.20%	1.60%	0.11%	0.00%	NA
Indica Intermediate	786	92.50%	7.40%	0.13%	0.00%	NA
Temperate Japonica	767	3.90%	96.10%	0.00%	0.00%	NA
Tropical Japonica	504	1.00%	99.00%	0.00%	0.00%	NA
Japonica Intermediate	241	0.80%	98.80%	0.41%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	50.00%	50.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0520272415	G -> A	LOC_Os05g34240.1	upstream_gene_variant ; 1268.0bp to feature; MODIFIER	silent_mutation	Average:32.541; most accessible tissue: Zhenshan97 root, score: 56.557	N	N	N	N
vg0520272415	G -> A	LOC_Os05g34240.2	upstream_gene_variant ; 1296.0bp to feature; MODIFIER	silent_mutation	Average:32.541; most accessible tissue: Zhenshan97 root, score: 56.557	N	N	N	N
vg0520272415	G -> A	LOC_Os05g34240.3	upstream_gene_variant ; 1268.0bp to feature; MODIFIER	silent_mutation	Average:32.541; most accessible tissue: Zhenshan97 root, score: 56.557	N	N	N	N
vg0520272415	G -> A	LOC_Os05g34260.1	downstream_gene_variant ; 4793.0bp to feature; MODIFIER	silent_mutation	Average:32.541; most accessible tissue: Zhenshan97 root, score: 56.557	N	N	N	N
vg0520272415	G -> A	LOC_Os05g34240-LOC_Os05g34260	intergenic_region ; MODIFIER	silent_mutation	Average:32.541; most accessible tissue: Zhenshan97 root, score: 56.557	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0520272415	NA	4.48E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	5.28E-07	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	3.08E-07	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	6.96E-06	mr1097	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	7.31E-11	mr1138	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	2.27E-16	mr1147	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	1.63E-12	mr1169	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	1.82E-26	mr1181	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	5.74E-06	7.78E-07	mr1187	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	2.03E-10	mr1195	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	1.18E-33	mr1208	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	3.75E-06	mr1208	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	4.66E-17	mr1270	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	7.77E-06	NA	mr1275	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	8.18E-11	mr1281	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	7.74E-06	mr1285	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	4.77E-13	mr1299	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	1.58E-10	mr1316	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	2.57E-08	mr1321	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	2.89E-12	mr1329	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	1.99E-06	5.76E-06	mr1331	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	9.43E-09	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	6.80E-07	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	5.20E-28	mr1426	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	3.30E-29	mr1436	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	4.28E-42	mr1458	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	3.19E-06	NA	mr1512	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	3.12E-10	mr1524	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	8.06E-26	mr1537	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	3.45E-25	mr1551	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	1.63E-18	mr1552	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	3.32E-07	mr1568	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	1.09E-07	1.09E-07	mr1568	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	4.66E-06	mr1661	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	1.15E-19	mr1700	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	6.71E-08	mr1716	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	2.33E-10	mr1720	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	2.14E-06	mr1727	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	6.49E-06	mr1749	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	4.79E-10	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	1.06E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	1.12E-09	mr1804	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	7.65E-13	mr1883	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0520272415	NA	1.25E-16	mr1916	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251