\
| Variant ID: vg0519909748 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr05 | Position: 19909748 |
| Reference Allele: TGC | Alternative Allele: T |
| Primary Allele: TGC | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGTACCACCTTGCTTATTCTAGGAGAGGGGGACCTCCTTAAAAGGGAGGATGCCCTCCTAGCCACTTGAAGCATGTGTGGTGGAGAGAAGAGGGGAAACA[TGC/T]
GCGCGCTCGCTCGCCTCGCCGGGCCGGGCCGGCAACGCGCGTGCACGACGTACGCGTCGAATGGTCCGAAAAATTGGCTCCTCACCCTTGCGCAGATGCA
TGCATCTGCGCAAGGGTGAGGAGCCAATTTTTCGGACCATTCGACGCGTACGTCGTGCACGCGCGTTGCCGGCCCGGCCCGGCGAGGCGAGCGAGCGCGC[GCA/A]
TGTTTCCCCTCTTCTCTCCACCACACATGCTTCAAGTGGCTAGGAGGGCATCCTCCCTTTTAAGGAGGTCCCCCTCTCCTAGAATAAGCAAGGTGGTACT
| Populations | Population Size | Frequency of TGC(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 29.40% | 0.30% | 1.71% | 68.54% | NA |
| All Indica | 2759 | 4.20% | 0.50% | 1.56% | 93.66% | NA |
| All Japonica | 1512 | 62.90% | 0.00% | 0.33% | 36.77% | NA |
| Aus | 269 | 74.70% | 0.00% | 11.90% | 13.38% | NA |
| Indica I | 595 | 0.70% | 0.00% | 0.50% | 98.82% | NA |
| Indica II | 465 | 1.30% | 0.00% | 0.86% | 97.85% | NA |
| Indica III | 913 | 6.50% | 1.50% | 2.52% | 89.49% | NA |
| Indica Intermediate | 786 | 6.10% | 0.10% | 1.65% | 92.11% | NA |
| Temperate Japonica | 767 | 94.70% | 0.00% | 0.00% | 5.35% | NA |
| Tropical Japonica | 504 | 7.10% | 0.00% | 0.60% | 92.26% | NA |
| Japonica Intermediate | 241 | 78.40% | 0.00% | 0.83% | 20.75% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 31.10% | 0.00% | 1.11% | 67.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0519909748 | TGC -> T | LOC_Os05g33790.1 | upstream_gene_variant ; 795.0bp to feature; MODIFIER | silent_mutation | Average:25.026; most accessible tissue: Minghui63 root, score: 55.188 | N | N | N | N |
| vg0519909748 | TGC -> T | LOC_Os05g33780-LOC_Os05g33790 | intergenic_region ; MODIFIER | silent_mutation | Average:25.026; most accessible tissue: Minghui63 root, score: 55.188 | N | N | N | N |
| vg0519909748 | TGC -> DEL | N | N | silent_mutation | Average:25.026; most accessible tissue: Minghui63 root, score: 55.188 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0519909748 | NA | 2.33E-07 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519909748 | NA | 2.25E-18 | mr1179 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519909748 | NA | 1.97E-06 | mr1231 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519909748 | NA | 3.49E-22 | mr1422 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519909748 | NA | 9.59E-09 | mr1446 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519909748 | 2.41E-06 | 2.41E-06 | mr1717 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519909748 | 7.20E-07 | 7.20E-07 | mr1770 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519909748 | NA | 2.67E-15 | mr1807 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519909748 | NA | 1.47E-08 | mr1989 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519909748 | NA | 2.42E-07 | mr1446_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519909748 | NA | 6.00E-17 | mr1457_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519909748 | NA | 6.34E-15 | mr1720_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519909748 | NA | 2.16E-15 | mr1807_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |