Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0519883737:

Variant ID: vg0519883737 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 19883737
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAATAAAAGTTACCCTCGAAATCGACGGAGATCGGTCTGACCGAAGTTGCCCTGCCGGTCTGACCACTCAGATGCCGTCGGTCTGACCGGTATAGATCAA[C/T]
CGGTCTGACCGCCGAAGCTCGCCGCGTCTGTCGCCGCCGCCGGTCTGACCACCGTGTTCTCGCCTGTTTGACCGCCGCTTGCCGCCGGTCTGACCGTCGA

Reverse complement sequence

TCGACGGTCAGACCGGCGGCAAGCGGCGGTCAAACAGGCGAGAACACGGTGGTCAGACCGGCGGCGGCGACAGACGCGGCGAGCTTCGGCGGTCAGACCG[G/A]
TTGATCTATACCGGTCAGACCGACGGCATCTGAGTGGTCAGACCGGCAGGGCAACTTCGGTCAGACCGATCTCCGTCGATTTCGAGGGTAACTTTTATTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.30%	0.20%	1.44%	9.04%	NA
All Indica	2759	99.90%	0.00%	0.04%	0.11%	NA
All Japonica	1512	67.70%	0.60%	4.17%	27.51%	NA
Aus	269	99.30%	0.00%	0.37%	0.37%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.00%	0.22%	0.22%	NA
Indica III	913	99.90%	0.00%	0.00%	0.11%	NA
Indica Intermediate	786	99.90%	0.00%	0.00%	0.13%	NA
Temperate Japonica	767	98.60%	0.00%	0.13%	1.30%	NA
Tropical Japonica	504	13.50%	1.80%	11.31%	73.41%	NA
Japonica Intermediate	241	83.00%	0.00%	2.07%	14.94%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	87.80%	1.10%	3.33%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0519883737	C -> T	LOC_Os05g33750.1	upstream_gene_variant ; 740.0bp to feature; MODIFIER	silent_mutation	Average:56.615; most accessible tissue: Minghui63 young leaf, score: 72.959	N	N	N	N
vg0519883737	C -> T	LOC_Os05g33750-LOC_Os05g33760	intergenic_region ; MODIFIER	silent_mutation	Average:56.615; most accessible tissue: Minghui63 young leaf, score: 72.959	N	N	N	N
vg0519883737	C -> DEL	N	N	silent_mutation	Average:56.615; most accessible tissue: Minghui63 young leaf, score: 72.959	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0519883737	NA	8.99E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519883737	NA	5.19E-06	mr1236_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519883737	2.45E-07	2.80E-09	mr1498_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251