\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0519790388:

Variant ID: vg0519790388 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 19790388
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


AATATTCCTTATTTTTTTAATTCCGAATTTCAGTTATTTATAAATTGTATTTCTATATGGACTCTAGTCTCCTCTTCTAATATTCCTTATTTTTTAATTC[C/T]
GAATTTCAACTATTTCTAAATTGTATTTTTATATGGACTCTGTTTTTATTTTTCTCCAATTAATATGAGAATTTATAAACCGTGAGAGCGAACGTGGAGG

Reverse complement sequence

CCTCCACGTTCGCTCTCACGGTTTATAAATTCTCATATTAATTGGAGAAAAATAAAAACAGAGTCCATATAAAAATACAATTTAGAAATAGTTGAAATTC[G/A]
GAATTAAAAAATAAGGAATATTAGAAGAGGAGACTAGAGTCCATATAGAAATACAATTTATAAATAACTGAAATTCGGAATTAAAAAAATAAGGAATATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.10% 40.50% 1.33% 0.00% NA
All Indica  2759 62.60% 36.40% 1.05% 0.00% NA
All Japonica  1512 61.40% 36.80% 1.79% 0.00% NA
Aus  269 11.50% 87.00% 1.49% 0.00% NA
Indica I  595 43.50% 56.00% 0.50% 0.00% NA
Indica II  465 58.50% 39.80% 1.72% 0.00% NA
Indica III  913 73.40% 25.80% 0.77% 0.00% NA
Indica Intermediate  786 66.90% 31.70% 1.40% 0.00% NA
Temperate Japonica  767 92.00% 5.50% 2.48% 0.00% NA
Tropical Japonica  504 8.90% 90.10% 0.99% 0.00% NA
Japonica Intermediate  241 73.40% 25.30% 1.24% 0.00% NA
VI/Aromatic  96 7.30% 91.70% 1.04% 0.00% NA
Intermediate  90 61.10% 36.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0519790388 C -> T LOC_Os05g33630.1 upstream_gene_variant ; 4426.0bp to feature; MODIFIER silent_mutation Average:47.273; most accessible tissue: Minghui63 young leaf, score: 91.206 N N N N
vg0519790388 C -> T LOC_Os05g33630.2 upstream_gene_variant ; 4591.0bp to feature; MODIFIER silent_mutation Average:47.273; most accessible tissue: Minghui63 young leaf, score: 91.206 N N N N
vg0519790388 C -> T LOC_Os05g33630.3 upstream_gene_variant ; 4426.0bp to feature; MODIFIER silent_mutation Average:47.273; most accessible tissue: Minghui63 young leaf, score: 91.206 N N N N
vg0519790388 C -> T LOC_Os05g33630.4 upstream_gene_variant ; 4426.0bp to feature; MODIFIER silent_mutation Average:47.273; most accessible tissue: Minghui63 young leaf, score: 91.206 N N N N
vg0519790388 C -> T LOC_Os05g33630.5 upstream_gene_variant ; 4426.0bp to feature; MODIFIER silent_mutation Average:47.273; most accessible tissue: Minghui63 young leaf, score: 91.206 N N N N
vg0519790388 C -> T LOC_Os05g33630.6 upstream_gene_variant ; 4426.0bp to feature; MODIFIER silent_mutation Average:47.273; most accessible tissue: Minghui63 young leaf, score: 91.206 N N N N
vg0519790388 C -> T LOC_Os05g33644.1 downstream_gene_variant ; 4412.0bp to feature; MODIFIER silent_mutation Average:47.273; most accessible tissue: Minghui63 young leaf, score: 91.206 N N N N
vg0519790388 C -> T LOC_Os05g33630-LOC_Os05g33644 intergenic_region ; MODIFIER silent_mutation Average:47.273; most accessible tissue: Minghui63 young leaf, score: 91.206 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0519790388 NA 5.66E-13 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0519790388 NA 2.26E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519790388 NA 1.42E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519790388 NA 8.40E-06 mr1295 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519790388 NA 1.88E-13 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519790388 NA 2.69E-06 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519790388 NA 4.32E-07 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519790388 NA 8.31E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519790388 NA 8.94E-06 mr1264_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519790388 NA 1.62E-15 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519790388 NA 2.72E-24 mr1593_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519790388 NA 4.65E-10 mr1807_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519790388 NA 3.70E-08 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251