\
| Variant ID: vg0519790388 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 19790388 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 116. )
AATATTCCTTATTTTTTTAATTCCGAATTTCAGTTATTTATAAATTGTATTTCTATATGGACTCTAGTCTCCTCTTCTAATATTCCTTATTTTTTAATTC[C/T]
GAATTTCAACTATTTCTAAATTGTATTTTTATATGGACTCTGTTTTTATTTTTCTCCAATTAATATGAGAATTTATAAACCGTGAGAGCGAACGTGGAGG
CCTCCACGTTCGCTCTCACGGTTTATAAATTCTCATATTAATTGGAGAAAAATAAAAACAGAGTCCATATAAAAATACAATTTAGAAATAGTTGAAATTC[G/A]
GAATTAAAAAATAAGGAATATTAGAAGAGGAGACTAGAGTCCATATAGAAATACAATTTATAAATAACTGAAATTCGGAATTAAAAAAATAAGGAATATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.10% | 40.50% | 1.33% | 0.00% | NA |
| All Indica | 2759 | 62.60% | 36.40% | 1.05% | 0.00% | NA |
| All Japonica | 1512 | 61.40% | 36.80% | 1.79% | 0.00% | NA |
| Aus | 269 | 11.50% | 87.00% | 1.49% | 0.00% | NA |
| Indica I | 595 | 43.50% | 56.00% | 0.50% | 0.00% | NA |
| Indica II | 465 | 58.50% | 39.80% | 1.72% | 0.00% | NA |
| Indica III | 913 | 73.40% | 25.80% | 0.77% | 0.00% | NA |
| Indica Intermediate | 786 | 66.90% | 31.70% | 1.40% | 0.00% | NA |
| Temperate Japonica | 767 | 92.00% | 5.50% | 2.48% | 0.00% | NA |
| Tropical Japonica | 504 | 8.90% | 90.10% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 73.40% | 25.30% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 7.30% | 91.70% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 36.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0519790388 | C -> T | LOC_Os05g33630.1 | upstream_gene_variant ; 4426.0bp to feature; MODIFIER | silent_mutation | Average:47.273; most accessible tissue: Minghui63 young leaf, score: 91.206 | N | N | N | N |
| vg0519790388 | C -> T | LOC_Os05g33630.2 | upstream_gene_variant ; 4591.0bp to feature; MODIFIER | silent_mutation | Average:47.273; most accessible tissue: Minghui63 young leaf, score: 91.206 | N | N | N | N |
| vg0519790388 | C -> T | LOC_Os05g33630.3 | upstream_gene_variant ; 4426.0bp to feature; MODIFIER | silent_mutation | Average:47.273; most accessible tissue: Minghui63 young leaf, score: 91.206 | N | N | N | N |
| vg0519790388 | C -> T | LOC_Os05g33630.4 | upstream_gene_variant ; 4426.0bp to feature; MODIFIER | silent_mutation | Average:47.273; most accessible tissue: Minghui63 young leaf, score: 91.206 | N | N | N | N |
| vg0519790388 | C -> T | LOC_Os05g33630.5 | upstream_gene_variant ; 4426.0bp to feature; MODIFIER | silent_mutation | Average:47.273; most accessible tissue: Minghui63 young leaf, score: 91.206 | N | N | N | N |
| vg0519790388 | C -> T | LOC_Os05g33630.6 | upstream_gene_variant ; 4426.0bp to feature; MODIFIER | silent_mutation | Average:47.273; most accessible tissue: Minghui63 young leaf, score: 91.206 | N | N | N | N |
| vg0519790388 | C -> T | LOC_Os05g33644.1 | downstream_gene_variant ; 4412.0bp to feature; MODIFIER | silent_mutation | Average:47.273; most accessible tissue: Minghui63 young leaf, score: 91.206 | N | N | N | N |
| vg0519790388 | C -> T | LOC_Os05g33630-LOC_Os05g33644 | intergenic_region ; MODIFIER | silent_mutation | Average:47.273; most accessible tissue: Minghui63 young leaf, score: 91.206 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0519790388 | NA | 5.66E-13 | Grain_thickness | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0519790388 | NA | 2.26E-06 | mr1124 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519790388 | NA | 1.42E-07 | mr1271 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519790388 | NA | 8.40E-06 | mr1295 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519790388 | NA | 1.88E-13 | mr1334 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519790388 | NA | 2.69E-06 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519790388 | NA | 4.32E-07 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519790388 | NA | 8.31E-06 | mr1642 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519790388 | NA | 8.94E-06 | mr1264_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519790388 | NA | 1.62E-15 | mr1334_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519790388 | NA | 2.72E-24 | mr1593_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519790388 | NA | 4.65E-10 | mr1807_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519790388 | NA | 3.70E-08 | mr1991_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |