\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0519769031:

Variant ID: vg0519769031 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 19769031
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


CGCGGCGGCGGCGGCGGGGGATCGGAGGGGGAGCAGGGCCACTCGGATGGTATTGGGCTTCGCCGGCGCCGGAGGCGGCGATCGCGGATGGGCGGCGGGC[G/A]
GGGCGGGGGCCGGGGGTTGTAGGTGGAGGAGGAGGAGGGGCGGTTCCGGAGTTTGGGGAGGGGGCGGCGGTGCTCGTGCTGGGGGAGGAGTGGGGAGGAG

Reverse complement sequence

CTCCTCCCCACTCCTCCCCCAGCACGAGCACCGCCGCCCCCTCCCCAAACTCCGGAACCGCCCCTCCTCCTCCTCCACCTACAACCCCCGGCCCCCGCCC[C/T]
GCCCGCCGCCCATCCGCGATCGCCGCCTCCGGCGCCGGCGAAGCCCAATACCATCCGAGTGGCCCTGCTCCCCCTCCGATCCCCCGCCGCCGCCGCCGCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.80% 20.40% 5.06% 1.71% NA
All Indica  2759 60.20% 33.40% 4.68% 1.67% NA
All Japonica  1512 89.90% 0.80% 7.08% 2.25% NA
Aus  269 92.60% 7.40% 0.00% 0.00% NA
Indica I  595 34.50% 55.60% 9.24% 0.67% NA
Indica II  465 59.40% 38.90% 1.29% 0.43% NA
Indica III  913 69.80% 24.30% 2.85% 3.07% NA
Indica Intermediate  786 69.20% 23.90% 5.34% 1.53% NA
Temperate Japonica  767 82.40% 0.80% 12.78% 4.04% NA
Tropical Japonica  504 98.80% 0.80% 0.00% 0.40% NA
Japonica Intermediate  241 95.00% 0.80% 3.73% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 83.30% 12.20% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0519769031 G -> DEL N N silent_mutation Average:98.12; most accessible tissue: Zhenshan97 flag leaf, score: 98.947 N N N N
vg0519769031 G -> A LOC_Os05g33610.1 5_prime_UTR_variant ; 112.0bp to feature; MODIFIER silent_mutation Average:98.12; most accessible tissue: Zhenshan97 flag leaf, score: 98.947 N N N N
vg0519769031 G -> A LOC_Os05g33610.3 5_prime_UTR_variant ; 112.0bp to feature; MODIFIER silent_mutation Average:98.12; most accessible tissue: Zhenshan97 flag leaf, score: 98.947 N N N N
vg0519769031 G -> A LOC_Os05g33610.2 5_prime_UTR_variant ; 112.0bp to feature; MODIFIER silent_mutation Average:98.12; most accessible tissue: Zhenshan97 flag leaf, score: 98.947 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0519769031 G A -0.01 -0.01 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0519769031 NA 2.55E-10 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519769031 NA 6.97E-07 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519769031 NA 3.69E-06 mr1324_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519769031 NA 2.06E-12 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519769031 NA 2.82E-06 mr1325_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519769031 NA 1.57E-13 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519769031 NA 5.55E-07 mr1326_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519769031 NA 5.16E-06 mr1333_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519769031 NA 4.19E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519769031 1.77E-06 9.30E-06 mr1719_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519769031 2.51E-06 1.42E-06 mr1719_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519769031 NA 5.88E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519769031 NA 1.23E-06 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251