Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0519715178:

Variant ID: vg0519715178 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 19715178
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


CTTGGGGGCGTCGCTTCGGAGAAGTTCCTATGCATCAACGACCGTGGATGGTCTTTTTCGGTTCTAAAGCTTTCATACCTTGACGTTCGGCGAGGCCTTC[G/A,T]
CCTCCTTGGGTCCGCTTCGTTCTTGTGGTGGGCGACAGGCTCTTCGGTTGCTTCTGCTGATGAAGTCGGAGCTGCTCGCTGATGGGGTGCGGCGATGCTT

Reverse complement sequence

AAGCATCGCCGCACCCCATCAGCGAGCAGCTCCGACTTCATCAGCAGAAGCAACCGAAGAGCCTGTCGCCCACCACAAGAACGAAGCGGACCCAAGGAGG[C/T,A]
GAAGGCCTCGCCGAACGTCAAGGTATGAAAGCTTTAGAACCGAAAAAGACCATCCACGGTCGTTGATGCATAGGAACTTCTCCGAAGCGACGCCCCCAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.40% 24.50% 0.66% 0.42% NA
All Indica  2759 56.90% 41.30% 1.09% 0.72% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 25.90% 72.90% 0.50% 0.67% NA
Indica II  465 64.10% 34.20% 0.86% 0.86% NA
Indica III  913 64.60% 32.60% 2.08% 0.66% NA
Indica Intermediate  786 67.00% 31.70% 0.51% 0.76% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 11.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0519715178 G -> T LOC_Os05g33560.1 synonymous_variant ; p.Arg64Arg; LOW N Average:76.052; most accessible tissue: Zhenshan97 flag leaf, score: 94.419 N N N N
vg0519715178 G -> T LOC_Os05g33570.1 downstream_gene_variant ; 3328.0bp to feature; MODIFIER N Average:76.052; most accessible tissue: Zhenshan97 flag leaf, score: 94.419 N N N N
vg0519715178 G -> T LOC_Os05g33570.2 downstream_gene_variant ; 3328.0bp to feature; MODIFIER N Average:76.052; most accessible tissue: Zhenshan97 flag leaf, score: 94.419 N N N N
vg0519715178 G -> DEL LOC_Os05g33560.1 N frameshift_variant Average:76.052; most accessible tissue: Zhenshan97 flag leaf, score: 94.419 N N N N
vg0519715178 G -> A LOC_Os05g33560.1 stop_gained ; p.Arg64*; HIGH stop_gained Average:76.052; most accessible tissue: Zhenshan97 flag leaf, score: 94.419 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0519715178 G A -0.01 -0.01 0.0 -0.01 -0.02 -0.02
vg0519715178 G T -0.03 -0.02 -0.02 -0.03 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0519715178 NA 4.54E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519715178 NA 5.75E-08 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519715178 NA 4.80E-07 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519715178 NA 2.03E-08 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519715178 1.46E-06 3.00E-15 mr1325_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519715178 7.35E-07 5.15E-08 mr1325_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519715178 NA 1.04E-13 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519715178 NA 2.14E-06 mr1326_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519715178 NA 3.25E-06 mr1333_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519715178 NA 7.37E-07 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519715178 NA 4.24E-08 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519715178 NA 5.01E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519715178 NA 3.52E-07 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251