Search for Variation information by Variation ID:
Detailed information for vg0519675004:
| Variant ID: vg0519675004 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 19675004 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 191. )
Flanking Sequence (100 bp) in Reference Genome:
ACTTTCTTGTATTCCCGCTTGGAGGAGTACGTTGTGGAGCCGCCGAAGATGTGTGAGACATGGAGGTCGGAGTCTGGGTACGCAGAATCCGATTCGTGAG[G/A]
AGGTGTCTCCTCGTTCTTCTCGACAACGCGTACTCGCTTGCCTTTTTCAAACGTCATGTGCTTCTCGAGCGACTTTTTGAAAACAAGGCAATCCTCCAGA
Reverse complement sequence
TCTGGAGGATTGCCTTGTTTTCAAAAAGTCGCTCGAGAAGCACATGACGTTTGAAAAAGGCAAGCGAGTACGCGTTGTCGAGAAGAACGAGGAGACACCT[C/T]
CTCACGAATCGGATTCTGCGTACCCAGACTCCGACCTCCATGTCTCACACATCTTCGGCGGCTCCACAACGTACTCCTCCAAGCGGGAATACAAGAAAGT
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.40% | 16.20% | 10.64% | 20.74% | NA |
| All Indica | 2759 | 35.30% | 19.40% | 15.69% | 29.61% | NA |
| All Japonica | 1512 | 91.20% | 0.10% | 0.46% | 8.20% | NA |
| Aus | 269 | 12.60% | 79.20% | 5.20% | 2.97% | NA |
| Indica I | 595 | 25.70% | 8.70% | 27.90% | 37.65% | NA |
| Indica II | 465 | 44.70% | 4.10% | 19.57% | 31.61% | NA |
| Indica III | 913 | 41.30% | 33.20% | 6.24% | 19.28% | NA |
| Indica Intermediate | 786 | 30.20% | 20.40% | 15.14% | 34.35% | NA |
| Temperate Japonica | 767 | 95.60% | 0.00% | 0.26% | 4.17% | NA |
| Tropical Japonica | 504 | 86.30% | 0.00% | 0.60% | 13.10% | NA |
| Japonica Intermediate | 241 | 87.60% | 0.80% | 0.83% | 10.79% | NA |
| VI/Aromatic | 96 | 36.50% | 10.40% | 43.75% | 9.38% | NA |
| Intermediate | 90 | 60.00% | 7.80% | 7.78% | 24.44% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0519675004 | G -> DEL | LOC_Os05g33490.1 | N | frameshift_variant | Average:16.903; most accessible tissue: Callus, score: 37.2 | N | N | N | N |
| vg0519675004 | G -> A | LOC_Os05g33490.1 | missense_variant ; p.Pro759Ser; MODERATE | nonsynonymous_codon ; P759S | Average:16.903; most accessible tissue: Callus, score: 37.2 | probably damaging  |
2.006 |
TOLERATED | 0.25 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0519675004 | NA | 8.74E-06 | mr1063 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519675004 | NA | 1.39E-06 | mr1177 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519675004 | NA | 6.26E-06 | mr1215 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519675004 | NA | 5.47E-07 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519675004 | NA | 1.68E-06 | mr1422 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519675004 | 3.92E-06 | 3.92E-06 | mr1447 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519675004 | NA | 8.28E-08 | mr1739 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519675004 | NA | 3.95E-08 | mr1739 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519675004 | 2.96E-06 | 2.96E-06 | mr1784 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0519675004 | NA | 1.56E-06 | mr1800 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |