\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0519674799:

Variant ID: vg0519674799 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 19674799
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCGAAGAGGAGATTGATCGAGCTGCCACCGTCGATGAGAACTCGTGCTACCTTGATGTTCCGAATAGTGGGTTCGACCACAATCGGATATCGTCTTGGG[C/A]
TAACAGAGGTCTTGGGGTGGTCTTCCTCCGAGAACTCTATTCTCTGTTCAGACCACTTCATCTTGGGTGCAGCCCCCTGCCATGTCGAATAGACTTCACG

Reverse complement sequence

CGTGAAGTCTATTCGACATGGCAGGGGGCTGCACCCAAGATGAAGTGGTCTGAACAGAGAATAGAGTTCTCGGAGGAAGACCACCCCAAGACCTCTGTTA[G/T]
CCCAAGACGATATCCGATTGTGGTCGAACCCACTATTCGGAACATCAAGGTAGCACGAGTTCTCATCGACGGTGGCAGCTCGATCAATCTCCTCTTCGCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 21.30% 18.60% 27.38% 32.71% NA
All Indica  2759 1.40% 11.50% 38.24% 48.86% NA
All Japonica  1512 62.90% 27.60% 0.66% 8.86% NA
Aus  269 0.40% 21.60% 69.52% 8.55% NA
Indica I  595 1.20% 2.90% 26.22% 69.75% NA
Indica II  465 1.70% 13.10% 27.74% 57.42% NA
Indica III  913 1.20% 16.60% 53.67% 28.48% NA
Indica Intermediate  786 1.80% 10.90% 35.62% 51.65% NA
Temperate Japonica  767 94.40% 0.80% 0.13% 4.69% NA
Tropical Japonica  504 8.10% 77.00% 0.99% 13.89% NA
Japonica Intermediate  241 77.20% 9.50% 1.66% 11.62% NA
VI/Aromatic  96 3.10% 61.50% 21.88% 13.54% NA
Intermediate  90 14.40% 31.10% 23.33% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0519674799 C -> DEL LOC_Os05g33490.1 N frameshift_variant Average:22.117; most accessible tissue: Callus, score: 33.49 N N N N
vg0519674799 C -> A LOC_Os05g33490.1 missense_variant ; p.Ser827Ile; MODERATE nonsynonymous_codon ; S827I Average:22.117; most accessible tissue: Callus, score: 33.49 possibly damaging -1.568 TOLERATED 0.44

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0519674799 6.20E-06 NA mr1113 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519674799 NA 1.56E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519674799 NA 3.13E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519674799 NA 5.15E-15 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519674799 NA 3.24E-12 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519674799 NA 8.77E-07 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519674799 NA 1.87E-10 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519674799 NA 4.33E-06 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519674799 3.80E-06 NA mr1589 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519674799 NA 3.61E-07 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519674799 NA 3.06E-07 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519674799 NA 3.61E-10 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519674799 NA 1.40E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519674799 NA 6.03E-10 mr1790 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519674799 NA 1.15E-12 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519674799 NA 2.07E-12 mr1879 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519674799 NA 7.61E-08 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519674799 NA 3.95E-06 mr1217_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519674799 NA 2.81E-17 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519674799 NA 1.78E-13 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0519674799 NA 1.75E-13 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251